Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408314423:

Variant ID: vg0408314423 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8314423
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGGCGGCGGAACGCGTAGAGAAAGCGGCCTCTGATTTCTTTTCTTTTTCTTTTCTGGAGATACTAAAAAATTGTTACGGAGTATTATATAAGCGAATC[G/T]
GGGAGGAATTCCGGCGGAGAAAATAGGGGAACAAGTTCCGTGATTTTTTTCTCTTTCTTTTCTGAAGATAATAAATAATGAGAGAATAGCTACTATAGTC

Reverse complement sequence

GACTATAGTAGCTATTCTCTCATTATTTATTATCTTCAGAAAAGAAAGAGAAAAAAATCACGGAACTTGTTCCCCTATTTTCTCCGCCGGAATTCCTCCC[C/A]
GATTCGCTTATATAATACTCCGTAACAATTTTTTAGTATCTCCAGAAAAGAAAAAGAAAAGAAATCAGAGGCCGCTTTCTCTACGCGTTCCGCCGCCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.00% 0.30% 0.06% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 66.50% 32.50% 0.86% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.00% 0.13% 0.00% NA
Tropical Japonica  504 15.90% 81.30% 2.38% 0.40% NA
Japonica Intermediate  241 75.50% 24.10% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408314423 G -> DEL N N silent_mutation Average:97.12; most accessible tissue: Minghui63 panicle, score: 98.576 N N N N
vg0408314423 G -> T LOC_Os04g14790.1 upstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:97.12; most accessible tissue: Minghui63 panicle, score: 98.576 N N N N
vg0408314423 G -> T LOC_Os04g14790-LOC_Os04g14810 intergenic_region ; MODIFIER silent_mutation Average:97.12; most accessible tissue: Minghui63 panicle, score: 98.576 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0408314423 G T -0.05 -0.03 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408314423 NA 1.19E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.72E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 7.00E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 2.18E-06 1.47E-26 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.31E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.50E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 7.34E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 6.53E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 9.41E-14 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.83E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 7.21E-15 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 1.00E-06 1.32E-12 mr1454 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.10E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.30E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.21E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.43E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.42E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 5.93E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.78E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.31E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.94E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.71E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.36E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 4.65E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 7.43E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.73E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 5.85E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 2.84E-06 3.19E-27 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 7.37E-18 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.52E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 4.23E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 3.58E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 2.30E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408314423 NA 1.24E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251