Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408234717:

Variant ID: vg0408234717 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8234717
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCCCTTCAAACAGGGAGCTCATGTTAGCCTAGTGGTGAGGATCACATTCTTGCTCCTCGCCAGCCAGAGTTCAAACCCCCAAAGTAGCACTTTTTCT[C/T]
ATTTTTAGGCAATAAAACGAACATGGGCCGCCGGAAGTGAAGTGGGCCTTGGAAGGCCGGCCCATCTCCTAGCTGACCTGCCGGTTTAGTATAGCCTGGT

Reverse complement sequence

ACCAGGCTATACTAAACCGGCAGGTCAGCTAGGAGATGGGCCGGCCTTCCAAGGCCCACTTCACTTCCGGCGGCCCATGTTCGTTTTATTGCCTAAAAAT[G/A]
AGAAAAAGTGCTACTTTGGGGGTTTGAACTCTGGCTGGCGAGGAGCAAGAATGTGATCCTCACCACTAGGCTAACATGAGCTCCCTGTTTGAAGGGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	9.10%	3.51%	5.40%	NA
All Indica	2759	72.70%	15.30%	5.69%	6.31%	NA
All Japonica	1512	95.10%	0.20%	0.26%	4.43%	NA
Aus	269	97.80%	0.00%	0.37%	1.86%	NA
Indica I	595	38.30%	42.90%	10.42%	8.40%	NA
Indica II	465	88.40%	3.70%	3.87%	4.09%	NA
Indica III	913	84.00%	5.90%	3.83%	6.24%	NA
Indica Intermediate	786	76.50%	12.10%	5.34%	6.11%	NA
Temperate Japonica	767	98.70%	0.00%	0.00%	1.30%	NA
Tropical Japonica	504	90.50%	0.40%	0.60%	8.53%	NA
Japonica Intermediate	241	93.40%	0.40%	0.41%	5.81%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	84.40%	4.40%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408234717	C -> DEL	N	N	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14654.1	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14654.2	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14654.3	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14670.1	downstream_gene_variant ; 2402.0bp to feature; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14680.1	downstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N
vg0408234717	C -> T	LOC_Os04g14654-LOC_Os04g14670	intergenic_region ; MODIFIER	silent_mutation	Average:89.439; most accessible tissue: Minghui63 panicle, score: 99.629	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0408234717	C	T	-0.03	-0.05	-0.04	-0.02	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408234717	NA	1.30E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	7.61E-06	mr1136_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	9.73E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	2.72E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	6.33E-06	NA	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	3.49E-06	1.05E-08	mr1308_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	3.03E-08	mr1361_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	6.81E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408234717	NA	3.85E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251