Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408205825:

Variant ID: vg0408205825 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8205825
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CCACGTGTCGCGAGGGTAGGCGAAACGGTAAATTACCATCGACCGAGCTACACAGTAAAAAGCCCGCAAAGGGAAGGCCCATTACTGTTCCTTTCTGCCC[A/G]
GGAAAAATAAAAAATATATATGCCACCCTCCGAAGGAGGCGAAGAGCAGCAAAATAATATCAGCCGCACAGATAACAAACTTTATTTGTAGGAACAATGT

Reverse complement sequence

ACATTGTTCCTACAAATAAAGTTTGTTATCTGTGCGGCTGATATTATTTTGCTGCTCTTCGCCTCCTTCGGAGGGTGGCATATATATTTTTTATTTTTCC[T/C]
GGGCAGAAAGGAACAGTAATGGGCCTTCCCTTTGCGGGCTTTTTACTGTGTAGCTCGGTCGATGGTAATTTACCGTTTCGCCTACCCTCGCGACACGTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	18.20%	0.17%	7.09%	NA
All Indica	2759	92.60%	0.50%	0.18%	6.67%	NA
All Japonica	1512	36.30%	54.20%	0.13%	9.33%	NA
Aus	269	96.70%	2.20%	0.00%	1.12%	NA
Indica I	595	84.20%	0.50%	0.34%	14.96%	NA
Indica II	465	95.90%	1.50%	0.00%	2.58%	NA
Indica III	913	96.60%	0.20%	0.11%	3.07%	NA
Indica Intermediate	786	92.40%	0.40%	0.25%	7.00%	NA
Temperate Japonica	767	3.30%	89.60%	0.00%	7.17%	NA
Tropical Japonica	504	91.10%	4.00%	0.00%	4.96%	NA
Japonica Intermediate	241	27.00%	46.90%	0.83%	25.31%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	21.10%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408205825	A -> DEL	N	N	silent_mutation	Average:43.074; most accessible tissue: Callus, score: 54.543	N	N	N	N
vg0408205825	A -> G	LOC_Os04g14630.1	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:43.074; most accessible tissue: Callus, score: 54.543	N	N	N	N
vg0408205825	A -> G	LOC_Os04g14640.1	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:43.074; most accessible tissue: Callus, score: 54.543	N	N	N	N
vg0408205825	A -> G	LOC_Os04g14620.1	downstream_gene_variant ; 3289.0bp to feature; MODIFIER	silent_mutation	Average:43.074; most accessible tissue: Callus, score: 54.543	N	N	N	N
vg0408205825	A -> G	LOC_Os04g14630-LOC_Os04g14640	intergenic_region ; MODIFIER	silent_mutation	Average:43.074; most accessible tissue: Callus, score: 54.543	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408205825	NA	8.23E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	4.65E-18	mr1401	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	2.50E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	8.82E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	2.41E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	5.06E-42	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	3.62E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	2.53E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	1.41E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408205825	NA	2.24E-32	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251