Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407995614:

Variant ID: vg0407995614 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7995614
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTCCGTCCATGGACTACACTGGCCTATCCACCAAAATTCCCCATGCATTTTGTATTTTGTGATGGTTTGATAACCCCTAACTAGCTAGCTTAATAAAC[T/C]
ATTTCTAGCTAGCTACCCTACCTACCTAGAAACACTATTGCCAATCTATCAATCCATCCTTTTTCAGCTAAATGTAAACATGATCTACAAAATTTTAACT

Reverse complement sequence

AGTTAAAATTTTGTAGATCATGTTTACATTTAGCTGAAAAAGGATGGATTGATAGATTGGCAATAGTGTTTCTAGGTAGGTAGGGTAGCTAGCTAGAAAT[A/G]
GTTTATTAAGCTAGCTAGTTAGGGGTTATCAAACCATCACAAAATACAAAATGCATGGGGAATTTTGGTGGATAGGCCAGTGTAGTCCATGGACGGAACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	31.10%	12.00%	4.40%	NA
All Indica	2759	42.80%	35.40%	16.46%	5.29%	NA
All Japonica	1512	64.20%	28.20%	3.70%	3.84%	NA
Aus	269	81.40%	5.90%	11.90%	0.74%	NA
Indica I	595	23.20%	33.40%	29.41%	13.95%	NA
Indica II	465	69.00%	13.30%	11.61%	6.02%	NA
Indica III	913	39.30%	51.80%	8.54%	0.33%	NA
Indica Intermediate	786	46.30%	30.90%	18.70%	4.07%	NA
Temperate Japonica	767	96.50%	2.10%	0.65%	0.78%	NA
Tropical Japonica	504	15.30%	72.20%	8.53%	3.97%	NA
Japonica Intermediate	241	63.90%	19.50%	3.32%	13.28%	NA
VI/Aromatic	96	62.50%	24.00%	12.50%	1.04%	NA
Intermediate	90	56.70%	27.80%	14.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407995614	T -> C	LOC_Os04g14260.1	upstream_gene_variant ; 2311.0bp to feature; MODIFIER	silent_mutation	Average:10.377; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N
vg0407995614	T -> C	LOC_Os04g14270.1	upstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:10.377; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N
vg0407995614	T -> C	LOC_Os04g14280.1	downstream_gene_variant ; 1777.0bp to feature; MODIFIER	silent_mutation	Average:10.377; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N
vg0407995614	T -> C	LOC_Os04g14260-LOC_Os04g14270	intergenic_region ; MODIFIER	silent_mutation	Average:10.377; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N
vg0407995614	T -> DEL	N	N	silent_mutation	Average:10.377; most accessible tissue: Minghui63 young leaf, score: 19.077	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407995614	NA	2.18E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407995614	NA	1.57E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407995614	NA	9.20E-07	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407995614	NA	6.67E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407995614	NA	5.14E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407995614	2.52E-07	2.52E-07	mr1899	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251