| Variant ID: vg0407954232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7954232 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACAGCTAGTGGTAGCTACTTTGTACTCCATCTAGTATCTCCTTTCAACTTAAAAAATACAACAGTATCTTCTTTTCTCATTCTACATGAAAACAAAAAT[G/C]
AAAGGGAAAAAAACAATCGATGATTAAACAGATTTATAGAGAGTTACTTTTGAACCATGCAAAAGTTACTACCAATTAACATTGAAGTTACTTTTAAAAA
TTTTTAAAAGTAACTTCAATGTTAATTGGTAGTAACTTTTGCATGGTTCAAAAGTAACTCTCTATAAATCTGTTTAATCATCGATTGTTTTTTTCCCTTT[C/G]
ATTTTTGTTTTCATGTAGAATGAGAAAAGAAGATACTGTTGTATTTTTTAAGTTGAAAGGAGATACTAGATGGAGTACAAAGTAGCTACCACTAGCTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 2.50% | 16.67% | 2.54% | NA |
| All Indica | 2759 | 68.50% | 3.60% | 23.85% | 4.02% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.66% | 0.13% | NA |
| Aus | 269 | 65.40% | 4.10% | 30.11% | 0.37% | NA |
| Indica I | 595 | 77.30% | 1.30% | 19.33% | 2.02% | NA |
| Indica II | 465 | 60.00% | 4.10% | 26.45% | 9.46% | NA |
| Indica III | 913 | 71.90% | 2.50% | 23.99% | 1.64% | NA |
| Indica Intermediate | 786 | 63.10% | 6.20% | 25.57% | 5.09% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 0.20% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 3.10% | 27.08% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 4.40% | 14.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407954232 | G -> C | LOC_Os04g14190.1 | downstream_gene_variant ; 4451.0bp to feature; MODIFIER | silent_mutation | Average:18.532; most accessible tissue: Callus, score: 31.305 | N | N | N | N |
| vg0407954232 | G -> C | LOC_Os04g14190-LOC_Os04g14200 | intergenic_region ; MODIFIER | silent_mutation | Average:18.532; most accessible tissue: Callus, score: 31.305 | N | N | N | N |
| vg0407954232 | G -> DEL | N | N | silent_mutation | Average:18.532; most accessible tissue: Callus, score: 31.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407954232 | NA | 2.60E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407954232 | NA | 1.80E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407954232 | 3.23E-06 | 3.23E-06 | mr1444 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407954232 | NA | 3.05E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407954232 | NA | 2.26E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407954232 | NA | 2.29E-11 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |