| Variant ID: vg0407737736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7737736 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACCATCCACCAGGGGAGTGTTCCACTCGTAAGGTCACATGTTTTCTATGCGAAGGTACAAACCATGTGCCCAAGGATTGCCAACTCATTGTGTTGTTGA[C/T]
CAAGACCACAGAAATCCAACGAACAACCCTACGATTGTCTCATCAGCTAGTCAGCTCCAACCACAACATCGACGATATCCTCCACAGCACCGATGCTCCT
AGGAGCATCGGTGCTGTGGAGGATATCGTCGATGTTGTGGTTGGAGCTGACTAGCTGATGAGACAATCGTAGGGTTGTTCGTTGGATTTCTGTGGTCTTG[G/A]
TCAACAACACAATGAGTTGGCAATCCTTGGGCACATGGTTTGTACCTTCGCATAGAAAACATGTGACCTTACGAGTGGAACACTCCCCTGGTGGATGGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 45.30% | 5.73% | 0.25% | NA |
| All Indica | 2759 | 24.80% | 72.30% | 2.86% | 0.00% | NA |
| All Japonica | 1512 | 96.30% | 1.20% | 1.72% | 0.79% | NA |
| Aus | 269 | 27.10% | 33.50% | 39.41% | 0.00% | NA |
| Indica I | 595 | 48.90% | 48.70% | 2.35% | 0.00% | NA |
| Indica II | 465 | 30.10% | 67.50% | 2.37% | 0.00% | NA |
| Indica III | 913 | 3.70% | 93.00% | 3.29% | 0.00% | NA |
| Indica Intermediate | 786 | 27.90% | 69.10% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 2.20% | 3.77% | 0.20% | NA |
| Japonica Intermediate | 241 | 91.30% | 2.10% | 2.07% | 4.56% | NA |
| VI/Aromatic | 96 | 37.50% | 3.10% | 59.38% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407737736 | C -> DEL | N | N | silent_mutation | Average:20.846; most accessible tissue: Callus, score: 41.621 | N | N | N | N |
| vg0407737736 | C -> T | LOC_Os04g13874.1 | downstream_gene_variant ; 2921.0bp to feature; MODIFIER | silent_mutation | Average:20.846; most accessible tissue: Callus, score: 41.621 | N | N | N | N |
| vg0407737736 | C -> T | LOC_Os04g13870.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.846; most accessible tissue: Callus, score: 41.621 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407737736 | NA | 1.04E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | NA | 7.75E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | NA | 2.90E-07 | mr1525 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | 3.22E-06 | 3.22E-06 | mr1551 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | 7.28E-08 | 7.27E-08 | mr1666 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | NA | 1.20E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407737736 | 3.48E-06 | 3.48E-06 | mr1872 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |