Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407717352:

Variant ID: vg0407717352 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7717352
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATTCATATCTTCGGAGTCAACCTCATACAAGTCACCACTTCATGTCATGCGTCAACACTAGCTTGTCATTACTAGGATACCAGGTTTGTCATCATAAG[A/G]
ATATCATGCTTGTCATTCACTTCTAACTTGCCACCAACTGTCTCATATTAGCTTTCCCGGTCTCCGGGTAATAGCTACTTCTGCTATTTGATGCCAGGGT

Reverse complement sequence

ACCCTGGCATCAAATAGCAGAAGTAGCTATTACCCGGAGACCGGGAAAGCTAATATGAGACAGTTGGTGGCAAGTTAGAAGTGAATGACAAGCATGATAT[T/C]
CTTATGATGACAAACCTGGTATCCTAGTAATGACAAGCTAGTGTTGACGCATGACATGAAGTGGTGACTTGTATGAGGTTGACTCCGAAGATATGAATCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	6.30%	11.83%	18.83%	NA
All Indica	2759	49.10%	4.00%	18.09%	28.81%	NA
All Japonica	1512	94.10%	0.00%	0.60%	5.29%	NA
Aus	269	22.70%	66.90%	10.41%	0.00%	NA
Indica I	595	54.60%	2.20%	13.45%	29.75%	NA
Indica II	465	46.90%	2.80%	21.72%	28.60%	NA
Indica III	913	44.50%	5.10%	20.92%	29.46%	NA
Indica Intermediate	786	51.70%	4.70%	16.16%	27.48%	NA
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	91.50%	0.00%	0.99%	7.54%	NA
Japonica Intermediate	241	87.60%	0.00%	1.24%	11.20%	NA
VI/Aromatic	96	71.90%	8.30%	16.67%	3.12%	NA
Intermediate	90	77.80%	1.10%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407717352	A -> DEL	N	N	silent_mutation	Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586	N	N	N	N
vg0407717352	A -> G	LOC_Os04g13820.1	upstream_gene_variant ; 2624.0bp to feature; MODIFIER	silent_mutation	Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586	N	N	N	N
vg0407717352	A -> G	LOC_Os04g13840.1	downstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586	N	N	N	N
vg0407717352	A -> G	LOC_Os04g13830.1	intron_variant ; MODIFIER	silent_mutation	Average:10.667; most accessible tissue: Minghui63 flag leaf, score: 15.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407717352	NA	1.18E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352	NA	4.75E-08	mr1414	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352	NA	6.54E-07	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352	NA	4.63E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352	NA	3.93E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407717352	NA	8.70E-06	mr1527_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251