| Variant ID: vg0407629243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7629243 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGGTCGGCCGATGAACCCTCGGCTATTAATGAGGGAGCACCCACAGCCTGTTGGGCAGACTGTGAATCAGCCGACTCAAGATCAGGTTGCTGCTATGTT[A/T]
TTGCCACCACCACCAATTGTTGATCCAGCGCAGCAGCAGCCGATCCAGCAGACATCATCAATTCAGCCGGTTGTACGGCCGATCCAACAACAGGTCGTGC
GCACGACCTGTTGTTGGATCGGCCGTACAACCGGCTGAATTGATGATGTCTGCTGGATCGGCTGCTGCTGCGCTGGATCAACAATTGGTGGTGGTGGCAA[T/A]
AACATAGCAGCAACCTGATCTTGAGTCGGCTGATTCACAGTCTGCCCAACAGGCTGTGGGTGCTCCCTCATTAATAGCCGAGGGTTCATCGGCCGACCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.70% | 1.10% | 3.07% | 60.14% | NA |
| All Indica | 2759 | 3.60% | 1.80% | 4.86% | 89.67% | NA |
| All Japonica | 1512 | 98.50% | 0.00% | 0.07% | 1.46% | NA |
| Aus | 269 | 1.10% | 0.00% | 2.60% | 96.28% | NA |
| Indica I | 595 | 3.70% | 0.30% | 1.01% | 94.96% | NA |
| Indica II | 465 | 5.40% | 1.30% | 4.30% | 89.03% | NA |
| Indica III | 913 | 1.90% | 2.80% | 5.48% | 89.81% | NA |
| Indica Intermediate | 786 | 4.60% | 2.20% | 7.38% | 85.88% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 0.20% | 2.58% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 52.10% | 0.00% | 1.04% | 46.88% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 2.22% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407629243 | A -> DEL | N | N | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| vg0407629243 | A -> T | LOC_Os04g13670.1 | upstream_gene_variant ; 583.0bp to feature; MODIFIER | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| vg0407629243 | A -> T | LOC_Os04g13680.1 | upstream_gene_variant ; 4031.0bp to feature; MODIFIER | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| vg0407629243 | A -> T | LOC_Os04g13650.1 | downstream_gene_variant ; 2270.0bp to feature; MODIFIER | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| vg0407629243 | A -> T | LOC_Os04g13660.1 | downstream_gene_variant ; 111.0bp to feature; MODIFIER | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| vg0407629243 | A -> T | LOC_Os04g13660-LOC_Os04g13670 | intergenic_region ; MODIFIER | silent_mutation | Average:21.609; most accessible tissue: Callus, score: 53.748 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407629243 | 4.26E-06 | NA | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 5.88E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 4.92E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | 5.30E-06 | NA | mr1404 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 2.95E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | 2.08E-06 | 2.01E-06 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | 3.12E-06 | NA | mr1560 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 1.30E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 9.11E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 9.09E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407629243 | NA | 1.02E-08 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |