Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407554949:

Variant ID: vg0407554949 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7554949
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGCAAAATCTATTATATACTAAAAGTCCATTGATCTTTCTAAAAACGCTCTCAAACCACCACATGGCCTCCTACACATGGCCTCCTACAAACGCT[C/T]
CTAAGTCGTCATGTGTCATTTTATAATCTCACTGTTGATTTTCTTTTAAATTGGTAGACCCATTAATTTTAATCGTTAGATCTCCATTAAAAAAATAAAT

Reverse complement sequence

ATTTATTTTTTTAATGGAGATCTAACGATTAAAATTAATGGGTCTACCAATTTAAAAGAAAATCAACAGTGAGATTATAAAATGACACATGACGACTTAG[G/A]
AGCGTTTGTAGGAGGCCATGTGTAGGAGGCCATGTGGTGGTTTGAGAGCGTTTTTAGAAAGATCAATGGACTTTTAGTATATAATAGATTTTGCTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	36.20%	0.11%	0.00%	NA
All Indica	2759	51.30%	48.50%	0.18%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	76.80%	23.00%	0.17%	0.00%	NA
Indica II	465	48.20%	51.80%	0.00%	0.00%	NA
Indica III	913	40.90%	59.00%	0.11%	0.00%	NA
Indica Intermediate	786	45.90%	53.70%	0.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407554949	C -> T	LOC_Os04g13540.1	upstream_gene_variant ; 244.0bp to feature; MODIFIER	silent_mutation	Average:53.907; most accessible tissue: Callus, score: 74.726	N	N	N	N
vg0407554949	C -> T	LOC_Os04g13530.1	downstream_gene_variant ; 3315.0bp to feature; MODIFIER	silent_mutation	Average:53.907; most accessible tissue: Callus, score: 74.726	N	N	N	N
vg0407554949	C -> T	LOC_Os04g13540-LOC_Os04g13550	intergenic_region ; MODIFIER	silent_mutation	Average:53.907; most accessible tissue: Callus, score: 74.726	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407554949	NA	1.17E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	7.55E-06	mr1304	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	2.05E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	2.66E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	1.07E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	4.45E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	3.47E-07	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	8.58E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	3.13E-17	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	7.67E-10	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	9.63E-10	1.29E-25	mr1846	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	1.13E-10	2.82E-18	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	1.24E-06	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	NA	6.55E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	2.30E-06	2.53E-19	mr1830_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	3.75E-06	2.04E-15	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	1.19E-11	5.55E-46	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949	3.43E-12	1.87E-32	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251