Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407554949:

Variant ID: vg0407554949 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7554949
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTAAGCAAAATCTATTATATACTAAAAGTCCATTGATCTTTCTAAAAACGCTCTCAAACCACCACATGGCCTCCTACACATGGCCTCCTACAAACGCT[C/T]
CTAAGTCGTCATGTGTCATTTTATAATCTCACTGTTGATTTTCTTTTAAATTGGTAGACCCATTAATTTTAATCGTTAGATCTCCATTAAAAAAATAAAT

Reverse complement sequence

ATTTATTTTTTTAATGGAGATCTAACGATTAAAATTAATGGGTCTACCAATTTAAAAGAAAATCAACAGTGAGATTATAAAATGACACATGACGACTTAG[G/A]
AGCGTTTGTAGGAGGCCATGTGTAGGAGGCCATGTGGTGGTTTGAGAGCGTTTTTAGAAAGATCAATGGACTTTTAGTATATAATAGATTTTGCTTACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.20% 0.11% 0.00% NA
All Indica  2759 51.30% 48.50% 0.18% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 76.80% 23.00% 0.17% 0.00% NA
Indica II  465 48.20% 51.80% 0.00% 0.00% NA
Indica III  913 40.90% 59.00% 0.11% 0.00% NA
Indica Intermediate  786 45.90% 53.70% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407554949 C -> T LOC_Os04g13540.1 upstream_gene_variant ; 244.0bp to feature; MODIFIER silent_mutation Average:53.907; most accessible tissue: Callus, score: 74.726 N N N N
vg0407554949 C -> T LOC_Os04g13530.1 downstream_gene_variant ; 3315.0bp to feature; MODIFIER silent_mutation Average:53.907; most accessible tissue: Callus, score: 74.726 N N N N
vg0407554949 C -> T LOC_Os04g13540-LOC_Os04g13550 intergenic_region ; MODIFIER silent_mutation Average:53.907; most accessible tissue: Callus, score: 74.726 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407554949 NA 1.17E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 7.55E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 2.05E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 2.66E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 1.07E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 4.45E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 3.47E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 8.58E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 3.13E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 7.67E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 9.63E-10 1.29E-25 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 1.13E-10 2.82E-18 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 1.24E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 NA 6.55E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 2.30E-06 2.53E-19 mr1830_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 3.75E-06 2.04E-15 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 1.19E-11 5.55E-46 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407554949 3.43E-12 1.87E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251