Variant ID: vg0407140848 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 7140848 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 90. )
GTAGAGTTAAAAGTACTCTAGTAATTTGGTTGGGAGTAACGTTAATCTGGTTAATTTCGATTAAGAGCAACCAAAATACTGTATTTTCTCTCTGTAAAAA[A/C]
ACTCCAAAAATACATTTTTTTTAATTTGAGAAACAACATTACAAACGTAGATACTCACAATACACATACACCCATATAAACGCACATATACACCCAACCT
AGGTTGGGTGTATATGTGCGTTTATATGGGTGTATGTGTATTGTGAGTATCTACGTTTGTAATGTTGTTTCTCAAATTAAAAAAAATGTATTTTTGGAGT[T/G]
TTTTTACAGAGAGAAAATACAGTATTTTGGTTGCTCTTAATCGAAATTAACCAGATTAACGTTACTCCCAACCAAATTACTAGAGTACTTTTAACTCTAC
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 37.60% | 22.10% | 1.61% | 38.64% | NA |
All Indica | 2759 | 21.30% | 30.90% | 1.45% | 46.32% | NA |
All Japonica | 1512 | 65.10% | 1.10% | 0.20% | 33.66% | NA |
Aus | 269 | 46.50% | 42.40% | 10.78% | 0.37% | NA |
Indica I | 595 | 6.10% | 20.20% | 2.02% | 71.76% | NA |
Indica II | 465 | 15.30% | 41.30% | 0.86% | 42.58% | NA |
Indica III | 913 | 32.10% | 31.00% | 0.66% | 36.25% | NA |
Indica Intermediate | 786 | 24.00% | 32.70% | 2.29% | 40.97% | NA |
Temperate Japonica | 767 | 98.00% | 0.30% | 0.00% | 1.69% | NA |
Tropical Japonica | 504 | 11.90% | 1.60% | 0.60% | 85.91% | NA |
Japonica Intermediate | 241 | 71.40% | 2.50% | 0.00% | 26.14% | NA |
VI/Aromatic | 96 | 42.70% | 40.60% | 2.08% | 14.58% | NA |
Intermediate | 90 | 43.30% | 27.80% | 2.22% | 26.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0407140848 | A -> C | LOC_Os04g12920.1 | upstream_gene_variant ; 3197.0bp to feature; MODIFIER | silent_mutation | Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 | N | N | N | N |
vg0407140848 | A -> C | LOC_Os04g12920-LOC_Os04g12950 | intergenic_region ; MODIFIER | silent_mutation | Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 | N | N | N | N |
vg0407140848 | A -> DEL | N | N | silent_mutation | Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0407140848 | NA | 1.06E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 3.31E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 6.66E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 9.13E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | 4.24E-06 | 7.26E-08 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 1.66E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 3.20E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 1.21E-11 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 6.65E-07 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0407140848 | NA | 1.59E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/