| Variant ID: vg0407024746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7024746 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 46. )
AAAATTTTGACATTGCCAAAACTTGGTAAGGTTTATTTTGGCTATAATCTGAACAGGCCCTAAAACTAACTCTTTTCTGCTATTTACTTTTTTTTTTTGC[G/A,T]
TACTAGTGTTACAAGATCCTTACATGAAGAAACTAGATGTATACAAAGCTATACTAATTTGATAAATATTTTGCTACAAATTCAGCAATGTTCTTGTCTG
CAGACAAGAACATTGCTGAATTTGTAGCAAAATATTTATCAAATTAGTATAGCTTTGTATACATCTAGTTTCTTCATGTAAGGATCTTGTAACACTAGTA[C/T,A]
GCAAAAAAAAAAAGTAAATAGCAGAAAAGAGTTAGTTTTAGGGCCTGTTCAGATTATAGCCAAAATAAACCTTACCAAGTTTTGGCAATGTCAAAATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 29.30% | 0.23% | 38.21% | NA |
| All Indica | 2759 | 10.40% | 49.10% | 0.36% | 40.05% | NA |
| All Japonica | 1512 | 65.40% | 0.70% | 0.00% | 33.93% | NA |
| Aus | 269 | 59.50% | 0.40% | 0.37% | 39.78% | NA |
| Indica I | 595 | 1.80% | 74.60% | 0.34% | 23.19% | NA |
| Indica II | 465 | 5.20% | 45.40% | 0.22% | 49.25% | NA |
| Indica III | 913 | 20.90% | 38.10% | 0.22% | 40.74% | NA |
| Indica Intermediate | 786 | 7.90% | 44.90% | 0.64% | 46.56% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 13.30% | 1.20% | 0.00% | 85.52% | NA |
| Japonica Intermediate | 241 | 70.50% | 1.70% | 0.00% | 27.80% | NA |
| VI/Aromatic | 96 | 53.10% | 0.00% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 37.80% | 22.20% | 0.00% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407024746 | G -> DEL | N | N | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> A | LOC_Os04g12669.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> A | LOC_Os04g12700.1 | upstream_gene_variant ; 2204.0bp to feature; MODIFIER | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> A | LOC_Os04g12690.1 | downstream_gene_variant ; 54.0bp to feature; MODIFIER | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> A | LOC_Os04g12710.1 | downstream_gene_variant ; 3584.0bp to feature; MODIFIER | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> A | LOC_Os04g12669-LOC_Os04g12690 | intergenic_region ; MODIFIER | silent_mutation | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> T | LOC_Os04g12669.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | N | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> T | LOC_Os04g12700.1 | upstream_gene_variant ; 2204.0bp to feature; MODIFIER | N | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> T | LOC_Os04g12690.1 | downstream_gene_variant ; 54.0bp to feature; MODIFIER | N | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> T | LOC_Os04g12710.1 | downstream_gene_variant ; 3584.0bp to feature; MODIFIER | N | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| vg0407024746 | G -> T | LOC_Os04g12669-LOC_Os04g12690 | intergenic_region ; MODIFIER | N | Average:11.55; most accessible tissue: Callus, score: 55.62 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407024746 | NA | 2.11E-06 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 3.32E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.76E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.48E-06 | mr1573 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 7.20E-06 | mr1696 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 4.67E-07 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | 1.49E-06 | 9.98E-06 | mr1833 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.83E-06 | mr1833 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.85E-10 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.81E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.34E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 6.45E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 1.44E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 3.55E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 7.16E-06 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407024746 | NA | 3.94E-19 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |