| Variant ID: vg0406987146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6987146 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.19, others allele: 0.00, population size: 245. )
GTCCAAGGAAGTGAGAAGTTTTGCTGAATCTTATGATATTAGGTTGTTGAGTTCTTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAAT[A/T]
AAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTTGGTATTTCAAGCTAGACGACTTGTCGGTTGGAGATTACAAGACCTTG
CAAGGTCTTGTAATCTCCAACCGACAAGTCGTCTAGCTTGAAATACCAAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGACAATTTCAACAATGTTT[T/A]
ATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAAGAACTCAACAACCTAATATCATAAGATTCAGCAAAACTTCTCACTTCCTTGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 15.20% | 0.74% | 17.44% | NA |
| All Indica | 2759 | 80.60% | 19.10% | 0.04% | 0.25% | NA |
| All Japonica | 1512 | 45.10% | 0.60% | 1.98% | 52.31% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 86.90% | 12.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 70.60% | 29.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.10% | 22.40% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 57.90% | 0.50% | 1.83% | 39.77% | NA |
| Tropical Japonica | 504 | 14.30% | 0.80% | 2.78% | 82.14% | NA |
| Japonica Intermediate | 241 | 68.90% | 0.40% | 0.83% | 29.88% | NA |
| VI/Aromatic | 96 | 77.10% | 8.30% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 67.80% | 14.40% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406987146 | A -> DEL | N | N | silent_mutation | Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0406987146 | A -> T | LOC_Os04g12610.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406987146 | 2.39E-06 | 2.39E-06 | mr1054 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | 1.38E-06 | 1.35E-08 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | NA | 3.04E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | 1.63E-06 | 1.07E-07 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | 8.01E-06 | 8.01E-06 | mr1287 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | 8.29E-06 | 1.11E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | NA | 4.33E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | NA | 6.91E-06 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | NA | 8.49E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987146 | NA | 1.15E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/