Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406944023:

Variant ID: vg0406944023 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6944023
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGAGCGGGTTGAGGATTAGCTAGGCAGTTAACAGCTCATTCGCCCTTCGCTCTCTAGCTCACTAATTACCAGTTTACCACATCTTTAGTTAGATATTC[T/C]
CTCCGACCCATAATATAAGATATTTTAGGTGTATTTAATGGGAATACCCTGGATCGGTCCCTCGGAGGAGGGAGAAATATCGGGCGCTCCCTCCCCACCC

Reverse complement sequence

GGGTGGGGAGGGAGCGCCCGATATTTCTCCCTCCTCCGAGGGACCGATCCAGGGTATTCCCATTAAATACACCTAAAATATCTTATATTATGGGTCGGAG[A/G]
GAATATCTAACTAAAGATGTGGTAAACTGGTAATTAGTGAGCTAGAGAGCGAAGGGCGAATGAGCTGTTAACTGCCTAGCTAATCCTCAACCCGCTCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 47.50% 0.06% 1.25% NA
All Indica  2759 82.20% 15.80% 0.11% 1.85% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.07% NA
Aus  269 27.50% 71.00% 0.00% 1.49% NA
Indica I  595 98.20% 0.70% 0.00% 1.18% NA
Indica II  465 92.30% 6.90% 0.00% 0.86% NA
Indica III  913 62.50% 33.80% 0.11% 3.50% NA
Indica Intermediate  786 87.20% 11.60% 0.25% 1.02% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.00% 0.20% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 67.70% 0.00% 3.12% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406944023 T -> C LOC_Os04g12540.1 upstream_gene_variant ; 1307.0bp to feature; MODIFIER silent_mutation Average:91.339; most accessible tissue: Callus, score: 96.299 N N N N
vg0406944023 T -> C LOC_Os04g12540-LOC_Os04g12550 intergenic_region ; MODIFIER silent_mutation Average:91.339; most accessible tissue: Callus, score: 96.299 N N N N
vg0406944023 T -> DEL N N silent_mutation Average:91.339; most accessible tissue: Callus, score: 96.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406944023 T C 0.03 0.03 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406944023 NA 2.68E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.24E-08 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.81E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.23E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 3.21E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.05E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 8.77E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 7.49E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 4.97E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.95E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 7.78E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 7.00E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 4.04E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.80E-20 mr1700 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.25E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.11E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 7.95E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.22E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 7.14E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.56E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.12E-11 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 9.21E-10 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.73E-09 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 2.27E-09 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 1.95E-07 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 5.89E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944023 NA 9.48E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251