Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406854973:

Variant ID: vg0406854973 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6854973
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCCAAGGGGCAAGAATATTTCTATCAAGAGAGTACTTTGGGTGCCTAACGCACTTGTTACTAACATGGGAGGACCCAAGCAAGTATGGGTACCTAAAA[C/T]
TAGAAATTGATCTCTTGTAGGAATATGTCTCCGGTGGAAGAAGTTGGGTGATTGATAGTGGATGCACCAATCACATGACCGGAGAAGAATCAATGTTTTC

Reverse complement sequence

GAAAACATTGATTCTTCTCCGGTCATGTGATTGGTGCATCCACTATCAATCACCCAACTTCTTCCACCGGAGACATATTCCTACAAGAGATCAATTTCTA[G/A]
TTTTAGGTACCCATACTTGCTTGGGTCCTCCCATGTTAGTAACAAGTGCGTTAGGCACCCAAAGTACTCTCTTGATAGAAATATTCTTGCCCCTTGGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 37.70% 2.92% 8.84% NA
All Indica  2759 27.60% 56.30% 4.20% 11.92% NA
All Japonica  1512 99.30% 0.30% 0.00% 0.46% NA
Aus  269 4.80% 69.90% 1.86% 23.42% NA
Indica I  595 8.40% 74.60% 4.03% 12.94% NA
Indica II  465 27.10% 58.70% 2.80% 11.40% NA
Indica III  913 38.80% 44.70% 4.05% 12.49% NA
Indica Intermediate  786 29.50% 54.30% 5.34% 10.81% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 56.20% 14.60% 16.67% 12.50% NA
Intermediate  90 64.40% 26.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406854973 C -> DEL N N silent_mutation Average:17.444; most accessible tissue: Callus, score: 30.311 N N N N
vg0406854973 C -> T LOC_Os04g12420.1 upstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:17.444; most accessible tissue: Callus, score: 30.311 N N N N
vg0406854973 C -> T LOC_Os04g12410.1 downstream_gene_variant ; 669.0bp to feature; MODIFIER silent_mutation Average:17.444; most accessible tissue: Callus, score: 30.311 N N N N
vg0406854973 C -> T LOC_Os04g12410-LOC_Os04g12420 intergenic_region ; MODIFIER silent_mutation Average:17.444; most accessible tissue: Callus, score: 30.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406854973 NA 3.65E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 3.61E-06 6.01E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 3.86E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 3.69E-06 NA mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 1.23E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 2.21E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 7.50E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 5.30E-06 NA mr1256 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 4.28E-06 4.28E-06 mr1270 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 4.26E-06 NA mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 4.98E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 3.77E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 8.52E-06 NA mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 7.34E-07 5.33E-07 mr1314 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 8.05E-06 NA mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 1.35E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 2.83E-06 2.83E-06 mr1393 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 4.77E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 3.36E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 7.59E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 4.77E-11 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 8.79E-07 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 3.02E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 2.21E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 4.25E-06 1.11E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 7.68E-07 7.68E-07 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 1.09E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 1.35E-06 1.35E-06 mr1661 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 6.69E-06 4.23E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 4.32E-06 NA mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 5.62E-06 5.62E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 4.45E-06 NA mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 7.51E-06 7.51E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 8.11E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 8.85E-06 8.85E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 1.32E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973 NA 8.25E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251