Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406854032:

Variant ID: vg0406854032 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6854032
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCGACTCCAAGTTAAGCTCAAGTGATGAAGAAGGAGCTGCCACGTTCACCGTCAAGCCTTCATCACCACCGAGACTCTTCGACCACTCAAGTGATGAG[G/A]
ATGCTCCCATTTGCCTCATGGCAAAGGAATCTAAGGTACCTTCTCCTCACAAGTCATTTAATGTTGATCTTGTTAGTGATGAGGAGGATGAGGTTCTGGA

Reverse complement sequence

TCCAGAACCTCATCCTCCTCATCACTAACAAGATCAACATTAAATGACTTGTGAGGAGAAGGTACCTTAGATTCCTTTGCCATGAGGCAAATGGGAGCAT[C/T]
CTCATCACTTGAGTGGTCGAAGAGTCTCGGTGGTGATGAAGGCTTGACGGTGAACGTGGCAGCTCCTTCTTCATCACTTGAGCTTAACTTGGAGTCGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 38.70% 6.62% 8.27% NA
All Indica  2759 23.00% 57.80% 9.79% 9.46% NA
All Japonica  1512 95.60% 0.40% 0.60% 3.37% NA
Aus  269 0.70% 70.60% 6.32% 22.30% NA
Indica I  595 8.40% 75.10% 4.71% 11.76% NA
Indica II  465 21.90% 63.70% 10.97% 3.44% NA
Indica III  913 28.80% 45.10% 14.79% 11.28% NA
Indica Intermediate  786 27.90% 55.90% 7.12% 9.16% NA
Temperate Japonica  767 97.00% 0.30% 0.00% 2.74% NA
Tropical Japonica  504 95.80% 0.40% 0.79% 2.98% NA
Japonica Intermediate  241 90.90% 0.80% 2.07% 6.22% NA
VI/Aromatic  96 55.20% 15.60% 15.62% 13.54% NA
Intermediate  90 64.40% 26.70% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406854032 G -> DEL LOC_Os04g12410.1 N frameshift_variant Average:26.514; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0406854032 G -> A LOC_Os04g12410.1 missense_variant ; p.Asp402Asn; MODERATE nonsynonymous_codon ; D402N Average:26.514; most accessible tissue: Minghui63 young leaf, score: 48.378 benign 0.407 TOLERATED 0.19

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406854032 NA 6.71E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 1.96E-09 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 1.36E-06 1.21E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 1.37E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 5.69E-08 NA mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 2.43E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 1.28E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 7.53E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 6.55E-06 NA mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 9.77E-08 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 8.74E-06 9.82E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 2.52E-14 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 4.73E-07 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 2.76E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 5.66E-06 NA mr1314 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 8.97E-06 3.30E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 5.92E-06 NA mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 9.11E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 3.54E-06 NA mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 6.93E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 4.60E-07 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 3.37E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 4.34E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 4.85E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 1.12E-10 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 1.28E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 6.06E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 6.85E-06 NA mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 5.11E-06 1.95E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 4.16E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 8.30E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 6.48E-06 6.48E-06 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 6.77E-07 4.48E-07 mr1661 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 5.37E-07 5.37E-07 mr1661 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 6.37E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 7.97E-06 7.97E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 2.26E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 8.83E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 1.23E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 8.92E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 3.33E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 1.93E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 4.87E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 7.35E-06 3.73E-21 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 7.21E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 3.03E-10 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 7.27E-07 1.24E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 1.35E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854032 NA 2.12E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251