Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406750129:

Variant ID: vg0406750129 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6750129
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATCTAGACTTTTTGTTTTATGTTAATATGCCCCTGTTGTTGCTGCCCCTGTGGACTATCTTTGCCCCTGCTGTTGCTGCCCCTGTGGTATATATACCC[C/A]
TGCTGCTGCTGTTTTATGTCAATAACATTCTATCTGTACCCTTGCTGCTGCTGTTTTTTAATTTTGCATGATTGATTCAGTGGTTATATCCCTCTACACT

Reverse complement sequence

AGTGTAGAGGGATATAACCACTGAATCAATCATGCAAAATTAAAAAACAGCAGCAGCAAGGGTACAGATAGAATGTTATTGACATAAAACAGCAGCAGCA[G/T]
GGGTATATATACCACAGGGGCAGCAACAGCAGGGGCAAAGATAGTCCACAGGGGCAGCAACAACAGGGGCATATTAACATAAAACAAAAAGTCTAGATAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	1.30%	16.04%	0.21%	NA
All Indica	2759	70.40%	2.10%	27.11%	0.36%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	91.40%	0.50%	7.90%	0.17%	NA
Indica II	465	56.10%	2.80%	40.65%	0.43%	NA
Indica III	913	65.80%	2.00%	31.98%	0.22%	NA
Indica Intermediate	786	68.20%	3.20%	27.99%	0.64%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	1.10%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406750129	C -> DEL	N	N	silent_mutation	Average:11.985; most accessible tissue: Callus, score: 39.052	N	N	N	N
vg0406750129	C -> A	LOC_Os04g12240.1	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:11.985; most accessible tissue: Callus, score: 39.052	N	N	N	N
vg0406750129	C -> A	LOC_Os04g12230.1	downstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:11.985; most accessible tissue: Callus, score: 39.052	N	N	N	N
vg0406750129	C -> A	LOC_Os04g12230-LOC_Os04g12240	intergenic_region ; MODIFIER	silent_mutation	Average:11.985; most accessible tissue: Callus, score: 39.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406750129	NA	1.77E-12	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	NA	2.28E-07	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	8.01E-09	NA	mr1458	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	6.04E-08	2.97E-11	mr1458	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	NA	1.93E-17	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	NA	6.71E-09	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	5.14E-08	NA	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406750129	4.51E-08	5.31E-13	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251