Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406345590:

Variant ID: vg0406345590 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6345590
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GGACCAATTGACGGAACCGATCCCAAGCCCTACATGTGCAGTTGCAAGCTATGATTAATTAATTATTACCCGAGATCAACATAATAGCAATGGAATCCCC[G/A]
CGACTTTGGAATAGATGGCATTATATTGCCTGTCTATCAGTTGGAAGACCTTGTCAAAAATCTTCTCCTCTTTATTCATTGAGTCGTACACAGTGACTCT

Reverse complement sequence

AGAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCCAACTGATAGACAGGCAATATAATGCCATCTATTCCAAAGTCG[C/T]
GGGGATTCCATTGCTATTATGTTGATCTCGGGTAATAATTAATTAATCATAGCTTGCAACTGCACATGTAGGGCTTGGGATCGGTTCCGTCAATTGGTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	9.50%	7.24%	2.96%	NA
All Indica	2759	89.10%	0.50%	6.52%	3.95%	NA
All Japonica	1512	65.70%	27.60%	4.70%	1.98%	NA
Aus	269	74.70%	0.40%	24.91%	0.00%	NA
Indica I	595	96.60%	0.00%	2.86%	0.50%	NA
Indica II	465	64.50%	1.10%	18.71%	15.70%	NA
Indica III	913	95.10%	0.20%	2.52%	2.19%	NA
Indica Intermediate	786	90.80%	0.80%	6.74%	1.65%	NA
Temperate Japonica	767	92.60%	2.10%	5.35%	0.00%	NA
Tropical Japonica	504	21.80%	69.40%	4.17%	4.56%	NA
Japonica Intermediate	241	71.80%	21.60%	3.73%	2.90%	NA
VI/Aromatic	96	78.10%	6.20%	15.62%	0.00%	NA
Intermediate	90	75.60%	13.30%	10.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406345590	G -> DEL	N	N	silent_mutation	Average:34.643; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0406345590	G -> A	LOC_Os04g11570.1	downstream_gene_variant ; 4428.0bp to feature; MODIFIER	silent_mutation	Average:34.643; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0406345590	G -> A	LOC_Os04g11590.1	downstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:34.643; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0406345590	G -> A	LOC_Os04g11600.1	downstream_gene_variant ; 4990.0bp to feature; MODIFIER	silent_mutation	Average:34.643; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg0406345590	G -> A	LOC_Os04g11580.1	intron_variant ; MODIFIER	silent_mutation	Average:34.643; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406345590	NA	6.23E-11	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	NA	1.62E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	NA	2.81E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	1.53E-08	NA	mr1071_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	2.27E-07	NA	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	2.37E-07	NA	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	5.36E-08	NA	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	1.22E-08	NA	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	2.44E-07	NA	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345590	1.53E-09	NA	mr1913_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251