Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406221879:

Variant ID: vg0406221879 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6221879
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAATTTGAAAACGGTAGCATGCGGCAGCCGGGATGGTGGCAATGGCAGCGGTGGCTCGGGTTGCCAATAGAGATGATGCCTCAGTGGTGGATTGGAGG[G/A]
GCGAAGCGGCGGCTAGGGCGCAGGGTGGAGCGGCGAAGCCATCTATGGTGGTGGCTATAGGGTGTCGGCGGTGGAGCTTGGGCTCGTGGAGGAGTCGGGG

Reverse complement sequence

CCCCGACTCCTCCACGAGCCCAAGCTCCACCGCCGACACCCTATAGCCACCACCATAGATGGCTTCGCCGCTCCACCCTGCGCCCTAGCCGCCGCTTCGC[C/T]
CCTCCAATCCACCACTGAGGCATCATCTCTATTGGCAACCCGAGCCACCGCTGCCATTGCCACCATCCCGGCTGCCGCATGCTACCGTTTTCAAATTCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	7.60%	0.47%	0.00%	NA
All Indica	2759	87.90%	11.30%	0.80%	0.00%	NA
All Japonica	1512	97.70%	2.30%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	93.40%	6.40%	0.17%	0.00%	NA
Indica II	465	86.70%	10.10%	3.23%	0.00%	NA
Indica III	913	90.30%	9.50%	0.22%	0.00%	NA
Indica Intermediate	786	81.80%	17.70%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406221879	G -> A	LOC_Os04g11390.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363	N	N	N	N
vg0406221879	G -> A	LOC_Os04g11390.2	downstream_gene_variant ; 3213.0bp to feature; MODIFIER	silent_mutation	Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363	N	N	N	N
vg0406221879	G -> A	LOC_Os04g11370-LOC_Os04g11390	intergenic_region ; MODIFIER	silent_mutation	Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406221879	7.97E-06	7.42E-08	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	7.65E-06	mr1210	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	1.66E-08	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	3.43E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	1.38E-08	mr1515	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	4.96E-07	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	NA	2.38E-07	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	3.22E-06	3.16E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879	5.10E-06	5.10E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251