Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405993315:

Variant ID: vg0405993315 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5993315
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATTAGTTATACTTTTGCGATGGAAGGAGTACTATTTACTTGTTGGTGCATGATGTAAACAAATGTTAGTTTTACTGCACGTATCTCCTATTGTACCA[A/T]
AGATAATAGGAATGTCTAGATGATCAAATACACGTTGAACTAATTCTATTCAAATTCTCTAAATATTTTCTCTACACTCTTTTATCTAAAGTTGGATGGA

Reverse complement sequence

TCCATCCAACTTTAGATAAAAGAGTGTAGAGAAAATATTTAGAGAATTTGAATAGAATTAGTTCAACGTGTATTTGATCATCTAGACATTCCTATTATCT[T/A]
TGGTACAATAGGAGATACGTGCAGTAAAACTAACATTTGTTTACATCATGCACCAACAAGTAAATAGTACTCCTTCCATCGCAAAAGTATAACTAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	2.10%	26.47%	13.69%	NA
All Indica	2759	35.20%	3.30%	40.45%	21.09%	NA
All Japonica	1512	98.50%	0.00%	1.39%	0.13%	NA
Aus	269	58.40%	1.90%	21.19%	18.59%	NA
Indica I	595	31.40%	3.70%	34.79%	30.08%	NA
Indica II	465	35.10%	4.70%	38.49%	21.72%	NA
Indica III	913	32.90%	2.60%	50.16%	14.35%	NA
Indica Intermediate	786	40.70%	2.90%	34.61%	21.76%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	98.40%	0.00%	1.39%	0.20%	NA
Japonica Intermediate	241	95.00%	0.00%	4.98%	0.00%	NA
VI/Aromatic	96	59.40%	3.10%	35.42%	2.08%	NA
Intermediate	90	60.00%	2.20%	25.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405993315	A -> DEL	N	N	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 64.77	N	N	N	N
vg0405993315	A -> T	LOC_Os04g11040.1	downstream_gene_variant ; 3081.0bp to feature; MODIFIER	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 64.77	N	N	N	N
vg0405993315	A -> T	LOC_Os04g11040-LOC_Os04g11050	intergenic_region ; MODIFIER	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 64.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405993315	NA	3.87E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315	2.47E-06	2.58E-07	mr1035	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315	NA	2.16E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315	NA	2.66E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315	NA	1.94E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315	NA	1.62E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251