| Variant ID: vg0405832497 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5832497 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAATCAAGATAAATATTATGAAAATTGTTAAAAAATATGATATAACATCTGTAGCCCCCGACTCACTAGTCAACGGCGAACCAGTTGATATAGTGAGGCA[G/A]
AGGAAAAGAAAAATATCATATAAAGAAAATTAACGATGACTTAGCTTTGTAATATTCCCCTTGGTGATGGCAGAGGTGGCCAATGTGGGAACAAAGTCGT
ACGACTTTGTTCCCACATTGGCCACCTCTGCCATCACCAAGGGGAATATTACAAAGCTAAGTCATCGTTAATTTTCTTTATATGATATTTTTCTTTTCCT[C/T]
TGCCTCACTATATCAACTGGTTCGCCGTTGACTAGTGAGTCGGGGGCTACAGATGTTATATCATATTTTTTAACAATTTTCATAATATTTATCTTGATTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 4.00% | 40.90% | 11.64% | NA |
| All Indica | 2759 | 31.80% | 0.00% | 56.43% | 11.71% | NA |
| All Japonica | 1512 | 68.90% | 12.20% | 5.49% | 13.36% | NA |
| Aus | 269 | 28.30% | 0.00% | 69.14% | 2.60% | NA |
| Indica I | 595 | 31.30% | 0.00% | 46.05% | 22.69% | NA |
| Indica II | 465 | 28.40% | 0.20% | 56.34% | 15.05% | NA |
| Indica III | 913 | 31.20% | 0.00% | 63.75% | 5.04% | NA |
| Indica Intermediate | 786 | 35.00% | 0.00% | 55.85% | 9.16% | NA |
| Temperate Japonica | 767 | 72.80% | 21.60% | 1.56% | 4.04% | NA |
| Tropical Japonica | 504 | 56.30% | 2.40% | 11.71% | 29.56% | NA |
| Japonica Intermediate | 241 | 83.00% | 2.90% | 4.98% | 9.13% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 83.33% | 2.08% | NA |
| Intermediate | 90 | 48.90% | 3.30% | 30.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405832497 | G -> DEL | N | N | silent_mutation | Average:17.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0405832497 | G -> A | LOC_Os04g10720.1 | upstream_gene_variant ; 4842.0bp to feature; MODIFIER | silent_mutation | Average:17.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0405832497 | G -> A | LOC_Os04g10724.1 | downstream_gene_variant ; 2784.0bp to feature; MODIFIER | silent_mutation | Average:17.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0405832497 | G -> A | LOC_Os04g10740.1 | downstream_gene_variant ; 2661.0bp to feature; MODIFIER | silent_mutation | Average:17.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0405832497 | G -> A | LOC_Os04g10730.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405832497 | NA | 3.60E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 1.48E-08 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 1.09E-06 | 3.40E-12 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | NA | 1.17E-07 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 3.28E-06 | 3.28E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | NA | 9.00E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | NA | 9.42E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 2.31E-09 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 9.85E-09 | 4.21E-14 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 2.87E-07 | 2.87E-07 | mr1525_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832497 | 3.30E-06 | 1.11E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |