Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405598798:

Variant ID: vg0405598798 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5598798
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGTCGACGCACCACTGCAGCCTCGCCATGGCCGCCGCCTCGCGCGGCCTGAGCCGGGCGGTGAACCCGCTGACGACGTGCTGGTAGGAGTAGACCAG[T/C,A]
CTCTCCCCGCCGATCACCGGCGCGCCCCTGTTGCCGCCGGCGCCAGCGCCGTAGAGGATCGCGTCGGTTGTGCTGTTGAGCACGGAGGCGAGCAGCGAGG

Reverse complement sequence

CCTCGCTGCTCGCCTCCGTGCTCAACAGCACAACCGACGCGATCCTCTACGGCGCTGGCGCCGGCGGCAACAGGGGCGCGCCGGTGATCGGCGGGGAGAG[A/G,T]
CTGGTCTACTCCTACCAGCACGTCGTCAGCGGGTTCACCGCCCGGCTCAGGCCGCGCGAGGCGGCGGCCATGGCGAGGCTGCAGTGGTGCGTCGACGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 36.00% 0.02% 0.00% A: 0.02%
All Indica  2759 92.20% 7.80% 0.04% 0.00% NA
All Japonica  1512 4.90% 95.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 89.70% 10.30% 0.00% 0.00% NA
Indica III  913 93.30% 6.60% 0.11% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 0.00% A: 1.04%
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405598798 T -> C LOC_Os04g10360.1 synonymous_variant ; p.Arg90Arg; LOW synonymous_codon Average:91.566; most accessible tissue: Zhenshan97 young leaf, score: 95.205 N N N N
vg0405598798 T -> A LOC_Os04g10360.1 missense_variant ; p.Arg90Ser; MODERATE nonsynonymous_codon ; R90S Average:91.566; most accessible tissue: Zhenshan97 young leaf, score: 95.205 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0405598798 T A 0.0 0.0 0.0 -0.01 0.0 0.0
vg0405598798 T C 0.02 0.02 0.03 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405598798 NA 9.11E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405598798 NA 7.37E-18 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 2.18E-06 1.90E-08 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.27E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.53E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.42E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 5.49E-06 1.99E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 4.82E-06 5.67E-33 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.61E-07 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.96E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 3.31E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.29E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.02E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 4.85E-06 2.26E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 3.55E-08 2.54E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.73E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.49E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.05E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.49E-62 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 3.59E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 8.87E-08 1.45E-07 mr1525_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 4.56E-34 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.46E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 8.99E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.25E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 3.79E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 4.31E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.02E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 5.40E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.51E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 2.65E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 5.54E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.43E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405598798 NA 1.60E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251