Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405227428:

Variant ID: vg0405227428 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5227428
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGCCTATTTAAAGAGCTCCTCTTCTCACTTCACTCACACACCTCAAGCAAAGCTCTCTCATATTCTCTTAAGTTTAGTTTAGTGTTCTTAAGCTAAT[G/A,T]
GAGTAGGAATAGAGTAGAAATCGGAGTCCGGAAGCCTTCGGAAGAGTTCGGGTATGGCTCTAGCAGCATTAGTTTCCTCTTTTGTAAGCTTTGTACTTTT

Reverse complement sequence

AAAAGTACAAAGCTTACAAAAGAGGAAACTAATGCTGCTAGAGCCATACCCGAACTCTTCCGAAGGCTTCCGGACTCCGATTTCTACTCTATTCCTACTC[C/T,A]
ATTAGCTTAAGAACACTAAACTAAACTTAAGAGAATATGAGAGAGCTTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGAGGAGCTCTTTAAATAGGCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.80%	30.60%	17.29%	4.23%	T: 0.02%
All Indica	2759	37.30%	35.80%	23.67%	3.26%	T: 0.04%
All Japonica	1512	64.20%	27.40%	7.01%	1.39%	NA
Aus	269	59.50%	3.00%	12.64%	24.91%	NA
Indica I	595	45.40%	22.70%	31.26%	0.67%	NA
Indica II	465	28.80%	43.90%	23.01%	4.30%	NA
Indica III	913	38.30%	38.30%	19.06%	4.16%	T: 0.11%
Indica Intermediate	786	34.90%	37.90%	23.66%	3.56%	NA
Temperate Japonica	767	87.10%	7.40%	5.22%	0.26%	NA
Tropical Japonica	504	28.40%	57.50%	11.11%	2.98%	NA
Japonica Intermediate	241	66.40%	27.80%	4.15%	1.66%	NA
VI/Aromatic	96	64.60%	11.50%	7.29%	16.67%	NA
Intermediate	90	44.40%	30.00%	18.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405227428	G -> DEL	N	N	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> A	LOC_Os04g09730.1	downstream_gene_variant ; 4951.0bp to feature; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> A	LOC_Os04g09740.1	downstream_gene_variant ; 2213.0bp to feature; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> A	LOC_Os04g09750.1	intron_variant ; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> T	LOC_Os04g09730.1	downstream_gene_variant ; 4951.0bp to feature; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> T	LOC_Os04g09740.1	downstream_gene_variant ; 2213.0bp to feature; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0405227428	G -> T	LOC_Os04g09750.1	intron_variant ; MODIFIER	silent_mutation	Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405227428	8.65E-07	8.64E-07	mr1407_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405227428	NA	6.57E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251