Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405152405:

Variant ID: vg0405152405 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5152405
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGTACCCGAACAGCACGCCGGCCAGCTGCTTGACGCGTTTCCCGTTCATGCCACCGCCGCCGGCGTTCTTGAACTGCAACGGTATCTCCTCCTTGGCT[C/T]
GCCGGATCAGCCTGACGACGTGCTTGAGGTCGCCGTTCGCCACCTCGTCGCTCGTCGGCACGGCCACCTGCGAGGTGACGCAGTTGCCGTAGTAGCCCTC

Reverse complement sequence

GAGGGCTACTACGGCAACTGCGTCACCTCGCAGGTGGCCGTGCCGACGAGCGACGAGGTGGCGAACGGCGACCTCAAGCACGTCGTCAGGCTGATCCGGC[G/A]
AGCCAAGGAGGAGATACCGTTGCAGTTCAAGAACGCCGGCGGCGGTGGCATGAACGGGAAACGCGTCAAGCAGCTGGCCGGCGTGCTGTTCGGGTACAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 44.50% 0.11% 0.00% NA
All Indica  2759 40.10% 59.80% 0.18% 0.00% NA
All Japonica  1512 74.50% 25.50% 0.00% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 63.50% 36.50% 0.00% 0.00% NA
Indica II  465 36.80% 63.00% 0.22% 0.00% NA
Indica III  913 19.40% 80.50% 0.11% 0.00% NA
Indica Intermediate  786 48.20% 51.40% 0.38% 0.00% NA
Temperate Japonica  767 63.90% 36.10% 0.00% 0.00% NA
Tropical Japonica  504 81.20% 18.80% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405152405 C -> T LOC_Os04g09590.1 missense_variant ; p.Arg327Gln; MODERATE nonsynonymous_codon ; R327Q Average:78.457; most accessible tissue: Zhenshan97 root, score: 95.471 benign 0.383 TOLERATED 0.22

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0405152405 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405152405 3.10E-08 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 2.22E-06 3.12E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 4.04E-06 NA mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 2.27E-06 2.27E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 1.97E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 3.59E-06 1.84E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 NA 2.72E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 7.44E-06 7.48E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405152405 2.66E-06 1.33E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251