Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405116756:

Variant ID: vg0405116756 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5116756
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GACAAGTCATGTGAGAACAATAAGGCTCTGTTTAGATATAGGGTTGTAAAGTTTTGACGTGTCACATCGGATATACGGATACATATTTGAAGTATTAAAC[A/G]
TAGACTAATAACAAAACAAATTACAGAATCCGTCTGTAAACTGTGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCAC

Reverse complement sequence

GTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCACAGTTTACAGACGGATTCTGTAATTTGTTTTGTTATTAGTCTA[T/C]
GTTTAATACTTCAAATATGTATCCGTATATCCGATGTGACACGTCAAAACTTTACAACCCTATATCTAAACAGAGCCTTATTGTTCTCACATGACTTGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	12.30%	2.45%	2.92%	NA
All Indica	2759	90.70%	1.00%	3.84%	4.42%	NA
All Japonica	1512	64.00%	35.80%	0.13%	0.07%	NA
Aus	269	94.40%	0.40%	1.86%	3.35%	NA
Indica I	595	88.20%	1.00%	8.91%	1.85%	NA
Indica II	465	96.60%	0.60%	2.15%	0.65%	NA
Indica III	913	87.60%	0.20%	2.41%	9.75%	NA
Indica Intermediate	786	92.70%	2.20%	2.67%	2.42%	NA
Temperate Japonica	767	58.80%	41.10%	0.13%	0.00%	NA
Tropical Japonica	504	81.90%	17.70%	0.20%	0.20%	NA
Japonica Intermediate	241	42.70%	57.30%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	2.08%	4.17%	NA
Intermediate	90	85.60%	11.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405116756	A -> DEL	N	N	silent_mutation	Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397	N	N	N	N
vg0405116756	A -> G	LOC_Os04g09530.1	upstream_gene_variant ; 3118.0bp to feature; MODIFIER	silent_mutation	Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397	N	N	N	N
vg0405116756	A -> G	LOC_Os04g09540.1	upstream_gene_variant ; 4271.0bp to feature; MODIFIER	silent_mutation	Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397	N	N	N	N
vg0405116756	A -> G	LOC_Os04g09530.2	upstream_gene_variant ; 3040.0bp to feature; MODIFIER	silent_mutation	Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397	N	N	N	N
vg0405116756	A -> G	LOC_Os04g09530-LOC_Os04g09540	intergenic_region ; MODIFIER	silent_mutation	Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405116756	NA	5.63E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756	NA	5.02E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756	6.08E-08	1.03E-06	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756	NA	3.74E-07	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756	NA	2.31E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756	8.71E-06	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251