Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405089971:

Variant ID: vg0405089971 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5089971
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTGGATGTTTCATAGAGTGGTGGATATCCTGTACAATCTAAGACAACATAGATATTTAACCTAATCAGCTGCCTTCCAATGATAGATGTTAGCCGATT[G/A]
AAGGTTAAATAACGGTATTTTTGAAGATTATACAGAATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGATGGAAGCACTAAT

Reverse complement sequence

ATTAGTGCTTCCATCTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATTCTGTATAATCTTCAAAAATACCGTTATTTAACCTT[C/T]
AATCGGCTAACATCTATCATTGGAAGGCAGCTGATTAGGTTAAATATCTATGTTGTCTTAGATTGTACAGGATATCCACCACTCTATGAAACATCCAACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	6.00%	1.08%	2.16%	NA
All Indica	2759	97.70%	0.30%	0.43%	1.59%	NA
All Japonica	1512	75.80%	18.10%	2.45%	3.70%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.30%	0.20%	0.17%	0.34%	NA
Indica II	465	93.10%	0.90%	1.08%	4.95%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	96.70%	0.30%	0.76%	2.29%	NA
Temperate Japonica	767	63.90%	32.70%	3.26%	0.13%	NA
Tropical Japonica	504	84.50%	2.60%	1.98%	10.91%	NA
Japonica Intermediate	241	95.40%	3.70%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405089971	G -> DEL	N	N	silent_mutation	Average:14.46; most accessible tissue: Callus, score: 28.144	N	N	N	N
vg0405089971	G -> A	LOC_Os04g09490.1	upstream_gene_variant ; 4892.0bp to feature; MODIFIER	silent_mutation	Average:14.46; most accessible tissue: Callus, score: 28.144	N	N	N	N
vg0405089971	G -> A	LOC_Os04g09500.1	upstream_gene_variant ; 881.0bp to feature; MODIFIER	silent_mutation	Average:14.46; most accessible tissue: Callus, score: 28.144	N	N	N	N
vg0405089971	G -> A	LOC_Os04g09510.1	upstream_gene_variant ; 445.0bp to feature; MODIFIER	silent_mutation	Average:14.46; most accessible tissue: Callus, score: 28.144	N	N	N	N
vg0405089971	G -> A	LOC_Os04g09500-LOC_Os04g09510	intergenic_region ; MODIFIER	silent_mutation	Average:14.46; most accessible tissue: Callus, score: 28.144	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405089971	1.09E-08	NA	mr1062	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089971	3.82E-06	7.30E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089971	6.38E-06	1.73E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251