Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405035806:

Variant ID: vg0405035806 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5035806
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GCATAAAAGGACATCATGTAAGTAGTTGCATGTAGCAAATACATTTATTGGGCAAATGAGTAATAGAATTATTCATATATCTTCTCTTTGTCCAATTGTC[G/A]
CCACATTTGTGGAAGACACAATTATATATTCTCCGCATAGAATAAATGTATACACTCATCATGAAGAGAGTATATTATTGACTTAGAGATATTTATTAGT

Reverse complement sequence

ACTAATAAATATCTCTAAGTCAATAATATACTCTCTTCATGATGAGTGTATACATTTATTCTATGCGGAGAATATATAATTGTGTCTTCCACAAATGTGG[C/T]
GACAATTGGACAAAGAGAAGATATATGAATAATTCTATTACTCATTTGCCCAATAAATGTATTTGCTACATGCAACTACTTACATGATGTCCTTTTATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	37.40%	0.38%	3.15%	NA
All Indica	2759	83.40%	13.40%	0.62%	2.65%	NA
All Japonica	1512	6.90%	88.20%	0.07%	4.83%	NA
Aus	269	91.10%	8.60%	0.00%	0.37%	NA
Indica I	595	89.70%	9.60%	0.17%	0.50%	NA
Indica II	465	81.90%	11.40%	1.94%	4.73%	NA
Indica III	913	83.10%	14.70%	0.00%	2.19%	NA
Indica Intermediate	786	79.60%	15.90%	0.89%	3.56%	NA
Temperate Japonica	767	1.00%	98.80%	0.00%	0.13%	NA
Tropical Japonica	504	15.70%	69.80%	0.20%	14.29%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405035806	G -> DEL	N	N	silent_mutation	Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672	N	N	N	N
vg0405035806	G -> A	LOC_Os04g09420.1	upstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672	N	N	N	N
vg0405035806	G -> A	LOC_Os04g09430.1	downstream_gene_variant ; 4544.0bp to feature; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672	N	N	N	N
vg0405035806	G -> A	LOC_Os04g09420-LOC_Os04g09430	intergenic_region ; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405035806	NA	3.99E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	6.89E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	2.88E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	1.57E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	2.27E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	1.76E-06	NA	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	1.89E-06	mr1274_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	5.89E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806	NA	1.04E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251