Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404875536:

Variant ID: vg0404875536 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4875536
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTCGGCTAGCTTTATTGATCATTAAACATTAAACATTGTTACATCGTTTGCCAAAGCGCTTAGAATATAACCAGGAGGTTCATCGACCCAAGTACAA[G/T,A]
ACTCTTTCGTACTAAAAGCAATAGTTCTTTCTTTATTGAAAAGGAAAACGTGATGAAGTTTCATTCCACACGTGTTTAGAATTCCATCTATAAATTAATT

Reverse complement sequence

AATTAATTTATAGATGGAATTCTAAACACGTGTGGAATGAAACTTCATCACGTTTTCCTTTTCAATAAAGAAAGAACTATTGCTTTTAGTACGAAAGAGT[C/A,T]
TTGTACTTGGGTCGATGAACCTCCTGGTTATATTCTAAGCGCTTTGGCAAACGATGTAACAATGTTTAATGTTTAATGATCAATAAAGCTAGCCGAATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	4.50%	1.40%	0.00%	NA
All Indica	2759	99.40%	0.20%	0.40%	0.00%	NA
All Japonica	1512	83.00%	13.40%	3.64%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	97.80%	1.10%	1.08%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.51%	0.00%	NA
Temperate Japonica	767	69.60%	24.10%	6.26%	0.00%	NA
Tropical Japonica	504	97.20%	2.20%	0.60%	0.00%	NA
Japonica Intermediate	241	95.90%	2.50%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404875536	G -> A	LOC_Os04g08828.1	5_prime_UTR_variant ; 164.0bp to feature; MODIFIER	N	Average:40.501; most accessible tissue: Callus, score: 76.707	N	N	N	N
vg0404875536	G -> A	LOC_Os04g08824.1	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	N	Average:40.501; most accessible tissue: Callus, score: 76.707	N	N	N	N
vg0404875536	G -> T	LOC_Os04g08828.1	5_prime_UTR_variant ; 164.0bp to feature; MODIFIER	silent_mutation	Average:40.501; most accessible tissue: Callus, score: 76.707	N	N	N	N
vg0404875536	G -> T	LOC_Os04g08824.1	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:40.501; most accessible tissue: Callus, score: 76.707	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404875536	1.40E-07	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404875536	NA	5.00E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404875536	1.57E-06	1.20E-06	mr1525	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251