Variant ID: vg0404582911 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 4582911 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAGTTATATAGACAAATGACCAAAATAAAAGTTGTATATCTTGATGAGAGGATCAACTTTTTTGTTGACCATATTTCCATTTGAAATCATTTAGTATC[C/T]
GAAAATGTATTATGACTAATAAAATGAATTATTACACAACAGCTATATATTTTGTACGCACAAATATAAAGACTTGTTTGGAAAAATGGGAAAATAGTCA
TGACTATTTTCCCATTTTTCCAAACAAGTCTTTATATTTGTGCGTACAAAATATATAGCTGTTGTGTAATAATTCATTTTATTAGTCATAATACATTTTC[G/A]
GATACTAAATGATTTCAAATGGAAATATGGTCAACAAAAAAGTTGATCCTCTCATCAAGATATACAACTTTTATTTTGGTCATTTGTCTATATAACTTTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.20% | 4.70% | 0.17% | 0.00% | NA |
All Indica | 2759 | 98.00% | 1.70% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.40% | 0.43% | 0.00% | NA |
Indica III | 913 | 95.80% | 3.60% | 0.55% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0404582911 | C -> T | LOC_Os04g08480.1 | upstream_gene_variant ; 3344.0bp to feature; MODIFIER | silent_mutation | Average:19.53; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
vg0404582911 | C -> T | LOC_Os04g08480-LOC_Os04g08500 | intergenic_region ; MODIFIER | silent_mutation | Average:19.53; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0404582911 | 2.50E-06 | NA | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404582911 | 3.77E-07 | NA | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404582911 | 1.65E-06 | 3.06E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |