Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404394964:

Variant ID: vg0404394964 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4394964
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAGAAATCCGAGCCGTCCAGGTGAAAGCAGATGGCGGGAAGCACCAGGATTGGTTCGGCTGAACTGGTGGGTTCGGCCGAACCCAAAAACTCTCCTCC[T/C]
GGCCTCTCCTTCGGCCGGGAGGTTGCTTATTGCGTCCCCAACAACCTGGGCTATGTTTTGGCCCAATTCTAAATGGTTTTTATTGACTTATTGGGCCTCT

Reverse complement sequence

AGAGGCCCAATAAGTCAATAAAAACCATTTAGAATTGGGCCAAAACATAGCCCAGGTTGTTGGGGACGCAATAAGCAACCTCCCGGCCGAAGGAGAGGCC[A/G]
GGAGGAGAGTTTTTGGGTTCGGCCGAACCCACCAGTTCAGCCGAACCAATCCTGGTGCTTCCCGCCATCTGCTTTCACCTGGACGGCTCGGATTTCTCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	18.20%	9.50%	23.99%	NA
All Indica	2759	69.40%	2.40%	9.89%	18.30%	NA
All Japonica	1512	8.70%	50.10%	4.63%	36.57%	NA
Aus	269	37.20%	7.40%	32.34%	23.05%	NA
Indica I	595	94.30%	0.50%	1.18%	4.03%	NA
Indica II	465	71.00%	4.50%	7.10%	17.42%	NA
Indica III	913	57.30%	1.80%	15.22%	25.74%	NA
Indica Intermediate	786	63.70%	3.30%	11.96%	20.99%	NA
Temperate Japonica	767	3.10%	86.80%	0.78%	9.26%	NA
Tropical Japonica	504	14.90%	9.10%	8.93%	67.06%	NA
Japonica Intermediate	241	13.30%	19.10%	7.88%	59.75%	NA
VI/Aromatic	96	87.50%	0.00%	9.38%	3.12%	NA
Intermediate	90	60.00%	16.70%	11.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404394964	T -> C	LOC_Os04g08230.1	upstream_gene_variant ; 1301.0bp to feature; MODIFIER	silent_mutation	Average:23.393; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg0404394964	T -> C	LOC_Os04g08240.1	downstream_gene_variant ; 2277.0bp to feature; MODIFIER	silent_mutation	Average:23.393; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg0404394964	T -> C	LOC_Os04g08230-LOC_Os04g08240	intergenic_region ; MODIFIER	silent_mutation	Average:23.393; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg0404394964	T -> DEL	N	N	silent_mutation	Average:23.393; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404394964	NA	3.57E-09	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	2.34E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	3.94E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	2.09E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	6.21E-07	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	1.42E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	3.15E-10	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	6.11E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	1.60E-06	9.83E-11	mr1860_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404394964	NA	3.37E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251