Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404313730:

Variant ID: vg0404313730 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4313730
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTACTAGGAAATCTATTTTCATCTCTCAAGAGGATTTTCACTCGTTTTCCATATATATACCATTAAAATTCATCATTTTTTTTCTAAAAAATAACATGA[C/A,G]
AAATCGGTATATAATATATATCAATCCACAATTTAAAATTTACCTACAAAAGCTAAAAAAAAATTGACGCACGATTATACATATGGTTTTCGATCCACGC

Reverse complement sequence

GCGTGGATCGAAAACCATATGTATAATCGTGCGTCAATTTTTTTTTAGCTTTTGTAGGTAAATTTTAAATTGTGGATTGATATATATTATATACCGATTT[G/T,C]
TCATGTTATTTTTTAGAAAAAAAATGATGAATTTTAATGGTATATATATGGAAAACGAGTGAAAATCCTCTTGAGAGATGAAAATAGATTTCCTAGTACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 36.90% 0.11% 0.51% G: 0.04%
All Indica  2759 68.50% 31.30% 0.11% 0.00% G: 0.07%
All Japonica  1512 47.90% 50.50% 0.00% 1.59% NA
Aus  269 79.60% 19.70% 0.74% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 81.70% 18.30% 0.00% 0.00% NA
Indica III  913 43.50% 56.10% 0.22% 0.00% G: 0.22%
Indica Intermediate  786 70.10% 29.80% 0.13% 0.00% NA
Temperate Japonica  767 62.70% 37.30% 0.00% 0.00% NA
Tropical Japonica  504 19.80% 75.40% 0.00% 4.76% NA
Japonica Intermediate  241 59.80% 40.20% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404313730 C -> G LOC_Os04g08070.1 upstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:80.997; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0404313730 C -> G LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:80.997; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0404313730 C -> DEL N N silent_mutation Average:80.997; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0404313730 C -> A LOC_Os04g08070.1 upstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:80.997; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0404313730 C -> A LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:80.997; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404313730 C A 0.01 0.02 0.02 -0.01 0.01 0.02
vg0404313730 C G 0.0 -0.05 -0.03 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404313730 NA 7.67E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404313730 9.49E-07 1.42E-08 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404313730 NA 2.00E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404313730 3.40E-06 2.72E-06 mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404313730 5.08E-07 2.43E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251