Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404256297:

Variant ID: vg0404256297 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 4256297
Reference Allele: A	Alternative Allele: T,AT
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCTCCTATCCAAGGCATTTACTTTAAATGGTTGATGGAAATTTTAGCTCCCAGTCCATTCGATCTCCATCTTTTGAGTTTTCCAAAATATCCTAAAAA[A/T,AT]
TTTTTTTCAAAAGTTGGTTATTCCAAGTTGTTTGCCAAGAAAAGTTTCTCCATGAGAGGTCAATTTCTCTCAAGTCCAGATTGCTATATATGATTGCTTT

Reverse complement sequence

AAAGCAATCATATATAGCAATCTGGACTTGAGAGAAATTGACCTCTCATGGAGAAACTTTTCTTGGCAAACAACTTGGAATAACCAACTTTTGAAAAAAA[T/A,AT]
TTTTTAGGATATTTTGGAAAACTCAAAAGATGGAGATCGAATGGACTGGGAGCTAAAATTTCCATCAACCATTTAAAGTAAATGCCTTGGATAGGAGCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	34.60%	0.17%	1.90%	AT: 0.06%
All Indica	2759	86.80%	12.40%	0.18%	0.54%	AT: 0.04%
All Japonica	1512	29.60%	70.00%	0.13%	0.20%	AT: 0.07%
Aus	269	33.10%	42.40%	0.00%	24.54%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	80.00%	19.80%	0.22%	0.00%	NA
Indica III	913	89.20%	9.40%	0.33%	0.99%	AT: 0.11%
Indica Intermediate	786	81.80%	17.30%	0.13%	0.76%	NA
Temperate Japonica	767	41.70%	58.10%	0.00%	0.00%	AT: 0.13%
Tropical Japonica	504	8.90%	91.10%	0.00%	0.00%	NA
Japonica Intermediate	241	34.40%	63.50%	0.83%	1.24%	NA
VI/Aromatic	96	10.40%	88.50%	0.00%	1.04%	NA
Intermediate	90	51.10%	41.10%	1.11%	5.56%	AT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404256297	A -> DEL	N	N	silent_mutation	Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0404256297	A -> AT	LOC_Os04g07990.1	upstream_gene_variant ; 2430.0bp to feature; MODIFIER	silent_mutation	Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0404256297	A -> AT	LOC_Os04g07990-LOC_Os04g08010	intergenic_region ; MODIFIER	silent_mutation	Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0404256297	A -> T	LOC_Os04g07990.1	upstream_gene_variant ; 2429.0bp to feature; MODIFIER	silent_mutation	Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0404256297	A -> T	LOC_Os04g07990-LOC_Os04g08010	intergenic_region ; MODIFIER	silent_mutation	Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404256297	1.04E-06	3.09E-07	mr1035	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404256297	5.91E-06	3.08E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404256297	4.24E-06	4.24E-06	mr1035_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251