Search for Variation information by Variation ID:
Detailed information for vg0404086232:
| Variant ID: vg0404086232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4086232 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TATCTCCCTTCGACCTGCATTTTGTCGCCCGCACTGCCATCAAGTCCCAAGTCCTAGCTGACTTCGTGGCCAAATGGACACCGGCGTTCGCCTCCGAAAC[C/T]
GAGCCCGTCGAACAACCTTGGGTAATGTACTCCGACAGCTCGTGGTCACACAAGGGGGCGGGCGCCGTGGCGGTGCTCACTTCACCAGGGGGCATGCTGA
Reverse complement sequence
TCAGCATGCCCCCTGGTGAAGTGAGCACCGCCACGGCGCCCGCCCCCTTGTGTGACCACGAGCTGTCGGAGTACATTACCCAAGGTTGTTCGACGGGCTC[G/A]
GTTTCGGAGGCGAACGCCGGTGTCCATTTGGCCACGAAGTCAGCTAGGACTTGGGACTTGATGGCAGTGCGGGCGACAAAATGCAGGTCGAAGGGAGATA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 11.30% | 8.04% | 27.00% | NA |
| All Indica | 2759 | 47.00% | 3.40% | 11.67% | 37.91% | NA |
| All Japonica | 1512 | 59.70% | 28.00% | 1.19% | 11.11% | NA |
| Aus | 269 | 67.70% | 3.70% | 11.52% | 17.10% | NA |
| Indica I | 595 | 65.00% | 0.30% | 12.61% | 22.02% | NA |
| Indica II | 465 | 58.30% | 2.40% | 12.90% | 26.45% | NA |
| Indica III | 913 | 27.70% | 5.80% | 9.86% | 56.63% | NA |
| Indica Intermediate | 786 | 49.20% | 3.40% | 12.34% | 34.99% | NA |
| Temperate Japonica | 767 | 48.80% | 49.30% | 0.26% | 1.69% | NA |
| Tropical Japonica | 504 | 76.20% | 2.40% | 2.38% | 19.05% | NA |
| Japonica Intermediate | 241 | 59.80% | 14.10% | 1.66% | 24.48% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 68.90% | 6.70% | 8.89% | 15.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404086232 | C -> DEL | LOC_Os04g07670.1 | N | frameshift_variant | Average:41.946; most accessible tissue: Minghui63 flag leaf, score: 80.516 | N | N | N | N |
| vg0404086232 | C -> T | LOC_Os04g07670.1 | synonymous_variant ; p.Thr947Thr; LOW | synonymous_codon | Average:41.946; most accessible tissue: Minghui63 flag leaf, score: 80.516 | N | N | N | N |
| vg0404086232 | C -> T | LOC_Os04g07670.1 | synonymous_variant ; p.Thr947Thr; LOW | nonsynonymous_codon ; T947P | Average:41.946; most accessible tissue: Minghui63 flag leaf, score: 80.516 | probably damaging  |
-2.163 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404086232 | NA | 4.28E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0404086232 | NA | 5.91E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404086232 | 2.35E-08 | 1.58E-08 | mr1695_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404086232 | 2.07E-06 | NA | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |