Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403991999:

Variant ID: vg0403991999 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3991999
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCAAAGGTAATTGCCCAAGCACATAGCATTTGATAAATATGAGTATGCATAAATCTAGAGTAGCATTTCTAAGCATTTGTCATAGTTGTCTAGGGACT[T/C]
ATACGTAAATCATTGTTATAGGATTTAAGGGTAAACAATAATCAAGACATGGCATAATCACAAGTAGGATGTTCATCATTGCATGCAATTTTATTTGTAA

Reverse complement sequence

TTACAAATAAAATTGCATGCAATGATGAACATCCTACTTGTGATTATGCCATGTCTTGATTATTGTTTACCCTTAAATCCTATAACAATGATTTACGTAT[A/G]
AGTCCCTAGACAACTATGACAAATGCTTAGAAATGCTACTCTAGATTTATGCATACTCATATTTATCAAATGCTATGTGCTTGGGCAATTACCTTTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	0.50%	2.71%	22.92%	NA
All Indica	2759	69.70%	0.80%	2.65%	26.89%	NA
All Japonica	1512	78.00%	0.00%	2.45%	19.58%	NA
Aus	269	84.00%	0.00%	5.95%	10.04%	NA
Indica I	595	55.30%	1.50%	2.18%	41.01%	NA
Indica II	465	64.90%	1.50%	3.87%	29.68%	NA
Indica III	913	81.10%	0.30%	2.85%	15.77%	NA
Indica Intermediate	786	70.10%	0.40%	2.04%	27.48%	NA
Temperate Japonica	767	66.90%	0.00%	1.30%	31.81%	NA
Tropical Japonica	504	91.90%	0.00%	3.77%	4.37%	NA
Japonica Intermediate	241	84.20%	0.00%	3.32%	12.45%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	78.90%	0.00%	2.22%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403991999	T -> C	LOC_Os04g07500.1	upstream_gene_variant ; 1183.0bp to feature; MODIFIER	silent_mutation	Average:8.325; most accessible tissue: Callus, score: 19.814	N	N	N	N
vg0403991999	T -> C	LOC_Os04g07490-LOC_Os04g07500	intergenic_region ; MODIFIER	silent_mutation	Average:8.325; most accessible tissue: Callus, score: 19.814	N	N	N	N
vg0403991999	T -> DEL	N	N	silent_mutation	Average:8.325; most accessible tissue: Callus, score: 19.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403991999	7.86E-06	NA	mr1585	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403991999	5.70E-07	5.70E-07	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251