Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403780190:

Variant ID: vg0403780190 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3780190
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.14, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTCGCTGCAGGATTAGTGCCACAACATATACGAGATTTGCAATATTTATGATAAATAAAAGCATCCACAACCAACCTTCTAAACATGTTAGAGTTAAG[G/C,T]
CCCGAAAGGCGGTTGTGGTCCTCGCACGAGGGGTCAATACTAATCGAACATGATTCTGGGGATTCCTTATGTGAGCATGAATCCTGGGGGATTTTGAAAA

Reverse complement sequence

TTTTCAAAATCCCCCAGGATTCATGCTCACATAAGGAATCCCCAGAATCATGTTCGATTAGTATTGACCCCTCGTGCGAGGACCACAACCGCCTTTCGGG[C/G,A]
CTTAACTCTAACATGTTTAGAAGGTTGGTTGTGGATGCTTTTATTTATCATAAATATTGCAAATCTCGTATATGTTGTGGCACTAATCCTGCAGCGAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	21.00%	0.87%	19.19%	T: 0.02%
All Indica	2759	87.50%	5.70%	0.40%	6.31%	T: 0.04%
All Japonica	1512	5.90%	46.20%	1.72%	46.16%	NA
Aus	269	50.20%	43.50%	0.37%	5.95%	NA
Indica I	595	98.00%	0.80%	0.00%	1.18%	NA
Indica II	465	80.90%	5.80%	0.65%	12.69%	NA
Indica III	913	87.20%	7.00%	0.77%	5.04%	NA
Indica Intermediate	786	84.00%	7.90%	0.13%	7.89%	T: 0.13%
Temperate Japonica	767	2.70%	65.70%	1.43%	30.12%	NA
Tropical Japonica	504	9.90%	16.50%	2.18%	71.43%	NA
Japonica Intermediate	241	7.50%	46.50%	1.66%	44.40%	NA
VI/Aromatic	96	88.50%	2.10%	1.04%	8.33%	NA
Intermediate	90	65.60%	20.00%	2.22%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403780190	G -> C	LOC_Os04g07130.1	upstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> C	LOC_Os04g07120.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> C	LOC_Os04g07110-LOC_Os04g07120	intergenic_region ; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> DEL	N	N	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> T	LOC_Os04g07130.1	upstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> T	LOC_Os04g07120.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0403780190	G -> T	LOC_Os04g07110-LOC_Os04g07120	intergenic_region ; MODIFIER	silent_mutation	Average:17.287; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403780190	1.77E-06	1.77E-06	mr1824	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251