Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403566658:

Variant ID: vg0403566658 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3566658
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGATATGATCTCAAGTATGTCTCTAGGAATGTAAATTGCACAAATGTAAATGCGACAATCAAATGAGACAAGGAGACAAGAGATTTTTCACCGAGATT[C/T]
GGAAACTCGCCGGTTTCCTACTCCCCTTTGAGGCAAGCCCAACTCCACCGCTCAACCACGAAGCCTCCGCACGCCCCCTTCGTCAAGGGGTGGGTAAGGC

Reverse complement sequence

GCCTTACCCACCCCTTGACGAAGGGGGCGTGCGGAGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTTGCCTCAAAGGGGAGTAGGAAACCGGCGAGTTTCC[G/A]
AATCTCGGTGAAAAATCTCTTGTCTCCTTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATTTACATTCCTAGAGACATACTTGAGATCATATCACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	9.40%	0.00%	0.00%	NA
All Indica	2759	88.60%	11.40%	0.00%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	59.50%	40.50%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	76.20%	23.80%	0.00%	0.00%	NA
Indica Intermediate	786	89.80%	10.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403566658	C -> T	LOC_Os04g06770.1	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:40.728; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0403566658	C -> T	LOC_Os04g06780.1	upstream_gene_variant ; 913.0bp to feature; MODIFIER	silent_mutation	Average:40.728; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0403566658	C -> T	LOC_Os04g06770.2	upstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:40.728; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0403566658	C -> T	LOC_Os04g06780-LOC_Os04g06790	intergenic_region ; MODIFIER	silent_mutation	Average:40.728; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403566658	NA	2.96E-10	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	8.08E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	7.71E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	1.60E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	1.39E-06	1.30E-12	mr1108	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	1.02E-07	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	3.63E-10	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	3.36E-10	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	6.50E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	2.16E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	2.73E-09	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	3.08E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	5.22E-10	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	5.26E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	1.14E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	4.21E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	5.32E-06	2.39E-10	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566658	NA	4.35E-07	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251