Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403406131:

Variant ID: vg0403406131 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3406131
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTCCAATATACTCTGTGAAATATCACTAGAATTACAATATTATAAAAAGATGATTGTAAAAGTAGTTAAACATATTTTACCAGCTCCTATAATCTCT[A/T]
CCTCCCAATGAAAAGTTTAAAAATATTTACGTGTTGTTTGGTGATAAACATGTTTTATGGTCAAAGCAAATTTCTTTGTATTATATAATCCCTTAATTTC

Reverse complement sequence

GAAATTAAGGGATTATATAATACAAAGAAATTTGCTTTGACCATAAAACATGTTTATCACCAAACAACACGTAAATATTTTTAAACTTTTCATTGGGAGG[T/A]
AGAGATTATAGGAGCTGGTAAAATATGTTTAACTACTTTTACAATCATCTTTTTATAATATTGTAATTCTAGTGATATTTCACAGAGTATATTGGAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.50%	13.80%	9.46%	5.21%	NA
All Indica	2759	58.30%	23.30%	15.44%	2.90%	NA
All Japonica	1512	97.20%	0.10%	0.46%	2.25%	NA
Aus	269	67.70%	0.00%	0.37%	31.97%	NA
Indica I	595	19.20%	42.00%	36.30%	2.52%	NA
Indica II	465	60.20%	23.70%	15.05%	1.08%	NA
Indica III	913	79.60%	13.30%	3.29%	3.83%	NA
Indica Intermediate	786	62.10%	20.70%	13.99%	3.18%	NA
Temperate Japonica	767	99.20%	0.00%	0.65%	0.13%	NA
Tropical Japonica	504	93.70%	0.20%	0.20%	5.95%	NA
Japonica Intermediate	241	97.90%	0.40%	0.41%	1.24%	NA
VI/Aromatic	96	56.20%	0.00%	2.08%	41.67%	NA
Intermediate	90	72.20%	8.90%	12.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403406131	A -> DEL	N	N	silent_mutation	Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0403406131	A -> T	LOC_Os04g06490.1	upstream_gene_variant ; 500.0bp to feature; MODIFIER	silent_mutation	Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0403406131	A -> T	LOC_Os04g06530.1	downstream_gene_variant ; 1467.0bp to feature; MODIFIER	silent_mutation	Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0403406131	A -> T	LOC_Os04g06520.1	downstream_gene_variant ; 4597.0bp to feature; MODIFIER	silent_mutation	Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0403406131	A -> T	LOC_Os04g06490-LOC_Os04g06530	intergenic_region ; MODIFIER	silent_mutation	Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403406131	NA	3.47E-06	mr1217	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403406131	1.85E-06	1.85E-06	mr1845	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251