Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403221112:

Variant ID: vg0403221112 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3221112
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAACTGGTAGCAGCTGTGTCATCAACACGTGACAGTCATGAGACTTTAGGTTTGTGAACTTCTTCTCCTTCATGCTTATTATTCGCTTTATATTCGTGG[T/A]
GTATCCAGATGGTACCTTGATGCTCTCCAAGCATTCAAACATACTTTCCTTCTCTGCCTTGCTAAACGTGTAGCTGGCTGGACTCAAGTAATGGCTTTCT

Reverse complement sequence

AGAAAGCCATTACTTGAGTCCAGCCAGCTACACGTTTAGCAAGGCAGAGAAGGAAAGTATGTTTGAATGCTTGGAGAGCATCAAGGTACCATCTGGATAC[A/T]
CCACGAATATAAAGCGAATAATAAGCATGAAGGAGAAGAAGTTCACAAACCTAAAGTCTCATGACTGTCACGTGTTGATGACACAGCTGCTACCAGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	7.00%	7.77%	22.66%	NA
All Indica	2759	71.00%	6.10%	8.45%	14.46%	NA
All Japonica	1512	59.90%	0.50%	4.76%	34.92%	NA
Aus	269	7.10%	51.70%	6.32%	34.94%	NA
Indica I	595	98.30%	0.00%	1.18%	0.50%	NA
Indica II	465	77.20%	0.20%	7.31%	15.27%	NA
Indica III	913	47.40%	14.90%	13.69%	23.99%	NA
Indica Intermediate	786	73.90%	4.10%	8.52%	13.49%	NA
Temperate Japonica	767	79.80%	0.00%	1.04%	19.17%	NA
Tropical Japonica	504	31.70%	0.80%	10.12%	57.34%	NA
Japonica Intermediate	241	55.20%	1.20%	5.39%	38.17%	NA
VI/Aromatic	96	18.80%	9.40%	36.46%	35.42%	NA
Intermediate	90	62.20%	8.90%	11.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403221112	T -> DEL	N	N	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0403221112	T -> A	LOC_Os04g06190.1	upstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0403221112	T -> A	LOC_Os04g06210.1	upstream_gene_variant ; 1714.0bp to feature; MODIFIER	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0403221112	T -> A	LOC_Os04g06220.1	upstream_gene_variant ; 4010.0bp to feature; MODIFIER	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0403221112	T -> A	LOC_Os04g06200.1	downstream_gene_variant ; 133.0bp to feature; MODIFIER	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0403221112	T -> A	LOC_Os04g06190-LOC_Os04g06200	intergenic_region ; MODIFIER	silent_mutation	Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403221112	NA	9.06E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	NA	4.31E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	3.72E-06	8.40E-19	mr1583_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	NA	3.57E-09	mr1583_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	NA	6.21E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	NA	4.40E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112	NA	2.36E-06	mr1922_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251