| Variant ID: vg0403210904 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3210904 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACATCCATCTTCCCGCCTCTCAGGAAGTGGCTCCATCAGCATAGAAATCATCATGCAATATCCCATCCCACACAAGTTAAGAATTTAGAGTCTAACCAA[A/G]
TGTAATACATGTCCCGGTGCTCAATAACCGTGAGCACGGCTATCCGAATAGATTTCGTTTACTCACACTGCAGTGGATGTATACTTTACCCGCACTCCGC
GCGGAGTGCGGGTAAAGTATACATCCACTGCAGTGTGAGTAAACGAAATCTATTCGGATAGCCGTGCTCACGGTTATTGAGCACCGGGACATGTATTACA[T/C]
TTGGTTAGACTCTAAATTCTTAACTTGTGTGGGATGGGATATTGCATGATGATTTCTATGCTGATGGAGCCACTTCCTGAGAGGCGGGAAGATGGATGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 17.20% | 2.39% | 38.64% | NA |
| All Indica | 2759 | 63.70% | 4.70% | 0.83% | 30.74% | NA |
| All Japonica | 1512 | 11.10% | 43.10% | 1.46% | 44.31% | NA |
| Aus | 269 | 1.50% | 4.80% | 18.96% | 74.72% | NA |
| Indica I | 595 | 93.10% | 4.50% | 0.00% | 2.35% | NA |
| Indica II | 465 | 65.60% | 7.50% | 0.65% | 26.24% | NA |
| Indica III | 913 | 45.00% | 0.70% | 0.99% | 53.34% | NA |
| Indica Intermediate | 786 | 62.10% | 7.90% | 1.40% | 28.63% | NA |
| Temperate Japonica | 767 | 7.70% | 66.50% | 0.13% | 25.68% | NA |
| Tropical Japonica | 504 | 9.10% | 16.10% | 3.57% | 71.23% | NA |
| Japonica Intermediate | 241 | 26.10% | 25.30% | 1.24% | 47.30% | NA |
| VI/Aromatic | 96 | 6.20% | 3.10% | 13.54% | 77.08% | NA |
| Intermediate | 90 | 42.20% | 16.70% | 4.44% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403210904 | A -> DEL | N | N | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0403210904 | A -> G | LOC_Os04g06144.1 | upstream_gene_variant ; 4823.0bp to feature; MODIFIER | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0403210904 | A -> G | LOC_Os04g06160.1 | upstream_gene_variant ; 2738.0bp to feature; MODIFIER | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0403210904 | A -> G | LOC_Os04g06170.1 | upstream_gene_variant ; 1843.0bp to feature; MODIFIER | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0403210904 | A -> G | LOC_Os04g06180.1 | downstream_gene_variant ; 2805.0bp to feature; MODIFIER | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0403210904 | A -> G | LOC_Os04g06160-LOC_Os04g06170 | intergenic_region ; MODIFIER | silent_mutation | Average:11.662; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403210904 | NA | 2.99E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403210904 | NA | 5.86E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403210904 | NA | 5.05E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403210904 | 3.89E-06 | 3.88E-06 | mr1919_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |