Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402479779:

Variant ID: vg0402479779 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2479779
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GTGATTCAGTCATTCTCCCTGGTTCAGTCCATTCTCACTCCCTTCATCTAGGTCCAGTTTAAACTAGATCTATACGGGTTAAAATGAAACATTTCTAATG[A/G]
GCAAACTTGTTTATTTGACACTGGATATAATAAAATAATGTGTCCCGTATCCCGTAGCTAATTAATATGTTTTCACAAGTATTCTCTAACAAAGACATAT

Reverse complement sequence

ATATGTCTTTGTTAGAGAATACTTGTGAAAACATATTAATTAGCTACGGGATACGGGACACATTATTTTATTATATCCAGTGTCAAATAAACAAGTTTGC[T/C]
CATTAGAAATGTTTCATTTTAACCCGTATAGATCTAGTTTAAACTGGACCTAGATGAAGGGAGTGAGAATGGACTGAACCAGGGAGAATGACTGAATCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.70%	21.70%	0.51%	2.14%	NA
All Indica	2759	95.50%	2.40%	0.14%	1.96%	NA
All Japonica	1512	36.30%	59.30%	1.32%	3.11%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	94.40%	3.70%	0.00%	1.94%	NA
Indica III	913	95.30%	0.80%	0.22%	3.72%	NA
Indica Intermediate	786	94.10%	4.20%	0.25%	1.40%	NA
Temperate Japonica	767	26.60%	72.20%	0.52%	0.65%	NA
Tropical Japonica	504	52.00%	42.70%	3.17%	2.18%	NA
Japonica Intermediate	241	34.40%	52.70%	0.00%	12.86%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402479779	A -> DEL	N	N	silent_mutation	Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N
vg0402479779	A -> G	LOC_Os04g05050.1	upstream_gene_variant ; 754.0bp to feature; MODIFIER	silent_mutation	Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N
vg0402479779	A -> G	LOC_Os04g05050.2	upstream_gene_variant ; 3319.0bp to feature; MODIFIER	silent_mutation	Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N
vg0402479779	A -> G	LOC_Os04g05040-LOC_Os04g05050	intergenic_region ; MODIFIER	silent_mutation	Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402479779	1.23E-06	NA	mr1415	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779	1.23E-06	NA	mr1567	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779	3.57E-06	NA	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779	NA	2.61E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779	NA	6.33E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251