Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402461396:

Variant ID: vg0402461396 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2461396
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTCAAGCATTGGAAAAAGACTAGCTAGTGTCACTTTGCTGCTTCTCTAAGGCTCCATGCATATCTATAGTTAAACAAGTAGTTACTCTAACCGTTGA[T/A]
GAACACAAAAAGTCAGAGATTTCTTTCTAGCTAGTGATCAGAATCTCTGTTTGGTGGCAGTTTGGACTTTATGTTGTCAAATTAAGAGCTGCAGAAAATG

Reverse complement sequence

CATTTTCTGCAGCTCTTAATTTGACAACATAAAGTCCAAACTGCCACCAAACAGAGATTCTGATCACTAGCTAGAAAGAAATCTCTGACTTTTTGTGTTC[A/T]
TCAACGGTTAGAGTAACTACTTGTTTAACTATAGATATGCATGGAGCCTTAGAGAAGCAGCAAAGTGACACTAGCTAGTCTTTTTCCAATGCTTGACTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.60% 0.23% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 47.10% 52.30% 0.60% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 23.90% 75.20% 0.91% 0.00% NA
Tropical Japonica  504 71.40% 28.40% 0.20% 0.00% NA
Japonica Intermediate  241 70.10% 29.50% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402461396 T -> A LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:63.143; most accessible tissue: Zhenshan97 flower, score: 95.531 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402461396 T A -0.07 -0.04 -0.03 -0.01 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402461396 1.51E-07 5.59E-22 mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 NA 2.29E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 2.33E-08 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 NA 8.92E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 3.93E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 NA 4.08E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 1.64E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461396 NA 1.67E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251