| Variant ID: vg0402394297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2394297 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.37, others allele: 0.00, population size: 76. )
GGAGGATGATGTTTTCACAAGTTCAATAGTGGGGCGATGATATGGTATATTTAAATGTTAAGCTTTAATAGAAAATAATTGCTAGTGAGTGAATGTTCAC[A/G]
TGGTACATTTAAATGTTGAGCTTTAGAAATTAATAATTGTTAGTGGATTCTAATTTTAAAGTAAGTATAGATTGTAGGTGTAGACATTTCACTAATTACT
AGTAATTAGTGAAATGTCTACACCTACAATCTATACTTACTTTAAAATTAGAATCCACTAACAATTATTAATTTCTAAAGCTCAACATTTAAATGTACCA[T/C]
GTGAACATTCACTCACTAGCAATTATTTTCTATTAAAGCTTAACATTTAAATATACCATATCATCGCCCCACTATTGAACTTGTGAAAACATCATCCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 35.80% | 1.69% | 5.04% | NA |
| All Indica | 2759 | 75.50% | 17.00% | 0.91% | 6.52% | NA |
| All Japonica | 1512 | 36.10% | 60.40% | 3.24% | 0.26% | NA |
| Aus | 269 | 7.40% | 89.60% | 0.74% | 2.23% | NA |
| Indica I | 595 | 97.10% | 2.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 94.20% | 4.10% | 0.00% | 1.72% | NA |
| Indica III | 913 | 54.50% | 29.00% | 2.30% | 14.13% | NA |
| Indica Intermediate | 786 | 72.50% | 21.60% | 0.51% | 5.34% | NA |
| Temperate Japonica | 767 | 15.90% | 82.90% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 65.70% | 31.90% | 2.18% | 0.20% | NA |
| Japonica Intermediate | 241 | 38.60% | 48.10% | 12.03% | 1.24% | NA |
| VI/Aromatic | 96 | 17.70% | 35.40% | 1.04% | 45.83% | NA |
| Intermediate | 90 | 53.30% | 38.90% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402394297 | A -> DEL | N | N | silent_mutation | Average:35.782; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| vg0402394297 | A -> G | LOC_Os04g04950.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.782; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402394297 | NA | 2.89E-09 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 8.29E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 2.48E-11 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 9.78E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 1.96E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 1.38E-09 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 6.59E-10 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 3.18E-12 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 1.55E-12 | mr1111 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402394297 | NA | 5.24E-12 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/