Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402386328:

Variant ID: vg0402386328 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2386328
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAGGCCCCTGGACCTTTTCGGCTTGTTCTTCACTGGCAGCCACCTCAGAAGTTGTTCCAGTTTGAGGCTCTTCCTCGGCCCCAGTGGTCTGACCTACT[A/G]
GTGGGATTTCTTCATCGTCACCTCCTTTATTTTGGGGGCCACCTTTAGTCGAGGGTTCCTGGCTCTAGGGCCCTTGTTCCGGCTGGTCTTCGGATGACGG

Reverse complement sequence

CCGTCATCCGAAGACCAGCCGGAACAAGGGCCCTAGAGCCAGGAACCCTCGACTAAAGGTGGCCCCCAAAATAAAGGAGGTGACGATGAAGAAATCCCAC[T/C]
AGTAGGTCAGACCACTGGGGCCGAGGAAGAGCCTCAAACTGGAACAACTTCTGAGGTGGCTGCCAGTGAAGAACAAGCCGAAAAGGTCCAGGGGCCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	7.00%	0.36%	1.10%	NA
All Indica	2759	88.10%	9.60%	0.43%	1.88%	NA
All Japonica	1512	98.10%	1.90%	0.07%	0.00%	NA
Aus	269	90.00%	8.60%	1.49%	0.00%	NA
Indica I	595	94.60%	5.20%	0.00%	0.17%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	81.30%	13.70%	1.10%	3.94%	NA
Indica Intermediate	786	84.40%	13.50%	0.25%	1.91%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.40%	0.20%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402386328	A -> DEL	N	N	silent_mutation	Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723	N	N	N	N
vg0402386328	A -> G	LOC_Os04g04940.1	upstream_gene_variant ; 2163.0bp to feature; MODIFIER	silent_mutation	Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723	N	N	N	N
vg0402386328	A -> G	LOC_Os04g04950.1	downstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723	N	N	N	N
vg0402386328	A -> G	LOC_Os04g04940-LOC_Os04g04950	intergenic_region ; MODIFIER	silent_mutation	Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402386328	NA	4.41E-09	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	1.94E-06	NA	mr1798	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	4.97E-07	2.99E-14	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	5.96E-07	NA	mr1037_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	3.72E-10	6.93E-13	mr1037_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	6.05E-10	NA	mr1798_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328	1.73E-13	6.81E-31	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251