Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402373652:

Variant ID: vg0402373652 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2373652
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTATCTTTCTGCTTCCCAGTTTCTCATGCCCCATTTCTCAGCCAGGCCGAGCCTTCACTGACTTAATCGCCACCACCACCGGAAAAATCCCCAAAACC[A/C]
TATTCCAGCGCTACTCACAGAGCTCTAAAATTCGTCGCACACATCGCCAATCGTCTGAAATTGAAGGTAAAAATAGATTCTCCATGCCAAGTAGTCCCTT

Reverse complement sequence

AAGGGACTACTTGGCATGGAGAATCTATTTTTACCTTCAATTTCAGACGATTGGCGATGTGTGCGACGAATTTTAGAGCTCTGTGAGTAGCGCTGGAATA[T/G]
GGTTTTGGGGATTTTTCCGGTGGTGGTGGCGATTAAGTCAGTGAAGGCTCGGCCTGGCTGAGAAATGGGGCATGAGAAACTGGGAAGCAGAAAGATAGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	6.20%	0.42%	9.88%	NA
All Indica	2759	83.50%	6.90%	0.29%	9.39%	NA
All Japonica	1512	84.40%	3.50%	0.46%	11.64%	NA
Aus	269	89.20%	4.50%	0.37%	5.95%	NA
Indica I	595	97.60%	0.20%	0.34%	1.85%	NA
Indica II	465	97.60%	1.50%	0.00%	0.86%	NA
Indica III	913	66.90%	15.80%	0.22%	17.09%	NA
Indica Intermediate	786	83.60%	4.70%	0.51%	11.20%	NA
Temperate Japonica	767	97.70%	0.80%	0.13%	1.43%	NA
Tropical Japonica	504	73.60%	3.00%	0.79%	22.62%	NA
Japonica Intermediate	241	64.70%	13.30%	0.83%	21.16%	NA
VI/Aromatic	96	50.00%	36.50%	2.08%	11.46%	NA
Intermediate	90	86.70%	5.60%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402373652	A -> C	LOC_Os04g04930.1	upstream_gene_variant ; 826.0bp to feature; MODIFIER	silent_mutation	Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0402373652	A -> C	LOC_Os04g04914.1	downstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0402373652	A -> C	LOC_Os04g04914-LOC_Os04g04930	intergenic_region ; MODIFIER	silent_mutation	Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0402373652	A -> DEL	N	N	silent_mutation	Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402373652	3.81E-07	NA	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.77E-07	1.32E-12	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.95E-09	NA	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.50E-09	4.54E-18	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.33E-08	NA	mr1037_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.06E-09	6.60E-12	mr1037_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.45E-20	NA	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	1.49E-21	2.72E-39	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652	6.34E-06	NA	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251