RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0402179876:

Variant ID: vg0402179876 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2179876
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGCTAACTTGTTCTGCGGCGGTGGAGCATTGTTGTTCCCTTGGTTGAGCTGGTTCTGCTGGTTCTGGAGTTGCTGCATCATCATGTTCATAAGCTGTG[T/C]
CTGTTGAGCCAGAACCTGGGCAAGTGTGGGATTCTCTCCATTGTTGTTGTTATTGTTATTGTTGGGGCCATTCCCGTTGCTGCGAGTGAGCACCATCTGG

Reverse complement sequence

CCAGATGGTGCTCACTCGCAGCAACGGGAATGGCCCCAACAATAACAATAACAACAACAATGGAGAGAATCCCACACTTGCCCAGGTTCTGGCTCAACAG[A/G]
CACAGCTTATGAACATGATGATGCAGCAACTCCAGAACCAGCAGAACCAGCTCAACCAAGGGAACAACAATGCTCCACCGCCGCAGAACAAGTTAGCAGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.20%	4.00%	21.58%	26.22%	NA
All Indica	2759	45.00%	2.10%	21.93%	30.95%	NA
All Japonica	1512	60.80%	3.50%	16.47%	19.25%	NA
Aus	269	14.50%	26.80%	44.24%	14.50%	NA
Indica I	595	54.10%	1.00%	10.76%	34.12%	NA
Indica II	465	43.90%	1.10%	21.94%	33.12%	NA
Indica III	913	41.70%	3.70%	26.94%	27.60%	NA
Indica Intermediate	786	42.50%	1.80%	24.55%	31.17%	NA
Temperate Japonica	767	79.00%	3.10%	4.04%	13.82%	NA
Tropical Japonica	504	38.30%	1.20%	35.52%	25.00%	NA
Japonica Intermediate	241	49.80%	9.50%	16.18%	24.48%	NA
VI/Aromatic	96	26.00%	3.10%	31.25%	39.58%	NA
Intermediate	90	58.90%	3.30%	18.89%	18.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402179876	T -> C	LOC_Os04g04550.1	missense_variant ; p.Thr33Ala; MODERATE	nonsynonymous_codon ; T33A	Average:7.31; most accessible tissue: Zhenshan97 young leaf, score: 14.714	unknown	unknown	TOLERATED	0.39
vg0402179876	T -> DEL	LOC_Os04g04550.1	N	frameshift_variant	Average:7.31; most accessible tissue: Zhenshan97 young leaf, score: 14.714	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402179876	6.20E-07	6.20E-07	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	7.24E-06	1.15E-08	mr1101	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	2.79E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	8.81E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	2.26E-07	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	2.85E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	2.15E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	4.92E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	NA	4.91E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402179876	9.72E-06	3.22E-08	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 16 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0402179876:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact