Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401716915:

Variant ID: vg0401716915 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1716915
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.13, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTATGGATGAGGAAAGGTAGGATTTTATCACCATGTATATGGTGTCTCTGATTTGATAGCCTGGTAAACATTATAAACAAATATGAATCAATGTTGC[T/G]
CATGCATCACATGATTTCCAAAGATTCTGTTATATGGAAGCACTTATCATGTTAATGCTTCATTCAAATGTACAGAGCTACCTGAGGTACGCAGCATAAA

Reverse complement sequence

TTTATGCTGCGTACCTCAGGTAGCTCTGTACATTTGAATGAAGCATTAACATGATAAGTGCTTCCATATAACAGAATCTTTGGAAATCATGTGATGCATG[A/C]
GCAACATTGATTCATATTTGTTTATAATGTTTACCAGGCTATCAAATCAGAGACACCATATACATGGTGATAAAATCCTACCTTTCCTCATCCATAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 24.40% 0.15% 0.00% NA
All Indica  2759 95.50% 4.30% 0.22% 0.00% NA
All Japonica  1512 43.10% 56.80% 0.07% 0.00% NA
Aus  269 50.20% 49.80% 0.00% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 97.00% 2.80% 0.22% 0.00% NA
Indica III  913 96.80% 3.10% 0.11% 0.00% NA
Indica Intermediate  786 91.20% 8.50% 0.25% 0.00% NA
Temperate Japonica  767 48.20% 51.80% 0.00% 0.00% NA
Tropical Japonica  504 38.70% 61.10% 0.20% 0.00% NA
Japonica Intermediate  241 36.10% 63.90% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401716915 T -> G LOC_Os04g03820.1 upstream_gene_variant ; 4166.0bp to feature; MODIFIER silent_mutation Average:71.582; most accessible tissue: Minghui63 flag leaf, score: 85.151 N N N N
vg0401716915 T -> G LOC_Os04g03810.1 intron_variant ; MODIFIER silent_mutation Average:71.582; most accessible tissue: Minghui63 flag leaf, score: 85.151 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401716915 T G 0.02 0.02 0.0 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401716915 NA 1.21E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401716915 6.36E-08 NA mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401716915 7.28E-07 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401716915 2.14E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401716915 1.17E-07 NA mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251