Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401713889:

Variant ID: vg0401713889 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1713889
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGATGGCTATTCACAAAACTATGTTAAGTATTGCATGTGTGCATAATAGGTGGGGCCAAAACTTGTCAAACAAATAAGTTGTAACTTTCTGATAAAAT[C/T]
GTACTCTCTCTGTCCCACAAATAGGTAATCCTAGTATCCCAAAGTAAAATTTAAGGAGAGGATAAGTGACCAAACTACCTCTTATTATTAGTAAATTAGT

Reverse complement sequence

ACTAATTTACTAATAATAAGAGGTAGTTTGGTCACTTATCCTCTCCTTAAATTTTACTTTGGGATACTAGGATTACCTATTTGTGGGACAGAGAGAGTAC[G/A]
ATTTTATCAGAAAGTTACAACTTATTTGTTTGACAAGTTTTGGCCCCACCTATTATGCACACATGCAATACTTAACATAGTTTTGTGAATAGCCATCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	31.80%	1.21%	1.93%	NA
All Indica	2759	86.60%	8.40%	1.70%	3.26%	NA
All Japonica	1512	27.70%	71.60%	0.66%	0.00%	NA
Aus	269	48.70%	51.30%	0.00%	0.00%	NA
Indica I	595	79.80%	12.90%	3.36%	3.87%	NA
Indica II	465	92.90%	4.70%	1.08%	1.29%	NA
Indica III	913	91.90%	3.50%	0.99%	3.61%	NA
Indica Intermediate	786	81.80%	13.00%	1.65%	3.56%	NA
Temperate Japonica	767	28.00%	70.90%	1.04%	0.00%	NA
Tropical Japonica	504	28.60%	71.20%	0.20%	0.00%	NA
Japonica Intermediate	241	24.90%	74.70%	0.41%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401713889	C -> DEL	N	N	silent_mutation	Average:30.609; most accessible tissue: Callus, score: 53.182	N	N	N	N
vg0401713889	C -> T	LOC_Os04g03810.1	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:30.609; most accessible tissue: Callus, score: 53.182	N	N	N	N
vg0401713889	C -> T	LOC_Os04g03796.1	downstream_gene_variant ; 3370.0bp to feature; MODIFIER	silent_mutation	Average:30.609; most accessible tissue: Callus, score: 53.182	N	N	N	N
vg0401713889	C -> T	LOC_Os04g03796.2	downstream_gene_variant ; 3370.0bp to feature; MODIFIER	silent_mutation	Average:30.609; most accessible tissue: Callus, score: 53.182	N	N	N	N
vg0401713889	C -> T	LOC_Os04g03796-LOC_Os04g03810	intergenic_region ; MODIFIER	silent_mutation	Average:30.609; most accessible tissue: Callus, score: 53.182	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401713889	3.48E-06	NA	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	8.55E-07	6.22E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	9.31E-08	2.07E-09	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	NA	3.71E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	NA	2.56E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	4.27E-08	NA	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	4.44E-10	2.08E-11	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	3.61E-10	2.09E-11	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	NA	3.70E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	NA	1.43E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889	NA	9.41E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251