Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401712784:

Variant ID: vg0401712784 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1712784
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCGCAAATAGAATTGTAAGTGCATCCTCGAAAGCTCGTATATGTAATCGAGAATATCAGAATTTGAGCCTCGGTTAGAGTTATACACGCACTAATCGC[A/C]
ACGACGCCAAAACATATATGGTTCTTGTTTGAGTTTGAGTTTAAAGTTGTGCTTCTACATTTATCCTTCATAGCGTGGTACCTGTCTTTCAGTAGTTTTA

Reverse complement sequence

TAAAACTACTGAAAGACAGGTACCACGCTATGAAGGATAAATGTAGAAGCACAACTTTAAACTCAAACTCAAACAAGAACCATATATGTTTTGGCGTCGT[T/G]
GCGATTAGTGCGTGTATAACTCTAACCGAGGCTCAAATTCTGATATTCTCGATTACATATACGAGCTTTCGAGGATGCACTTACAATTCTATTTGCGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.80%	12.00%	3.13%	7.15%	NA
All Indica	2759	71.80%	14.80%	3.95%	9.46%	NA
All Japonica	1512	92.20%	6.80%	0.73%	0.26%	NA
Aus	269	62.10%	3.30%	8.18%	26.39%	NA
Indica I	595	86.60%	3.20%	4.54%	5.71%	NA
Indica II	465	42.80%	36.30%	2.80%	18.06%	NA
Indica III	913	77.20%	7.10%	5.26%	10.41%	NA
Indica Intermediate	786	71.60%	19.60%	2.67%	6.11%	NA
Temperate Japonica	767	89.00%	10.60%	0.26%	0.13%	NA
Tropical Japonica	504	95.00%	3.20%	1.59%	0.20%	NA
Japonica Intermediate	241	96.30%	2.50%	0.41%	0.83%	NA
VI/Aromatic	96	64.60%	32.30%	2.08%	1.04%	NA
Intermediate	90	77.80%	16.70%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401712784	A -> C	LOC_Os04g03810.1	upstream_gene_variant ; 1868.0bp to feature; MODIFIER	silent_mutation	Average:36.415; most accessible tissue: Callus, score: 75.657	N	N	N	N
vg0401712784	A -> C	LOC_Os04g03796.1	downstream_gene_variant ; 2265.0bp to feature; MODIFIER	silent_mutation	Average:36.415; most accessible tissue: Callus, score: 75.657	N	N	N	N
vg0401712784	A -> C	LOC_Os04g03796.2	downstream_gene_variant ; 2265.0bp to feature; MODIFIER	silent_mutation	Average:36.415; most accessible tissue: Callus, score: 75.657	N	N	N	N
vg0401712784	A -> C	LOC_Os04g03796-LOC_Os04g03810	intergenic_region ; MODIFIER	silent_mutation	Average:36.415; most accessible tissue: Callus, score: 75.657	N	N	N	N
vg0401712784	A -> DEL	N	N	silent_mutation	Average:36.415; most accessible tissue: Callus, score: 75.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401712784	NA	8.13E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	NA	4.56E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	NA	2.02E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	6.30E-06	NA	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	3.24E-06	NA	mr1256_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	NA	8.55E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401712784	NA	8.20E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251