Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401709039:

Variant ID: vg0401709039 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1709039
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTAACTGAAAAACGGAAATTAAGGAAGCGCATAAGTGTCAGGAGGTAAAATAATTGAGAAACTGAAAATATAGTAAGATCTCTTTCAGAGCACATACT[C/T]
TATACAAGGCCTGAGAAGAGCATACCGATAAGAGCCAGTAAATTCTGTCAAGGTGGTCAGTTTAATCACATATACATATTTTCCCTTTTGTGACTTAGGA

Reverse complement sequence

TCCTAAGTCACAAAAGGGAAAATATGTATATGTGATTAAACTGACCACCTTGACAGAATTTACTGGCTCTTATCGGTATGCTCTTCTCAGGCCTTGTATA[G/A]
AGTATGTGCTCTGAAAGAGATCTTACTATATTTTCAGTTTCTCAATTATTTTACCTCCTGACACTTATGCGCTTCCTTAATTTCCGTTTTTCAGTTACTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	32.70%	2.12%	22.89%	NA
All Indica	2759	60.10%	14.90%	2.03%	22.98%	NA
All Japonica	1512	11.90%	64.10%	1.85%	22.16%	NA
Aus	269	31.60%	44.20%	3.72%	20.45%	NA
Indica I	595	61.00%	31.60%	2.52%	4.87%	NA
Indica II	465	47.50%	10.80%	3.01%	38.71%	NA
Indica III	913	71.20%	3.00%	1.53%	24.32%	NA
Indica Intermediate	786	53.80%	18.70%	1.65%	25.83%	NA
Temperate Japonica	767	10.70%	74.80%	0.78%	13.69%	NA
Tropical Japonica	504	16.30%	49.60%	3.57%	30.56%	NA
Japonica Intermediate	241	6.60%	60.20%	1.66%	31.54%	NA
VI/Aromatic	96	47.90%	11.50%	4.17%	36.46%	NA
Intermediate	90	32.20%	40.00%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401709039	C -> DEL	N	N	silent_mutation	Average:36.258; most accessible tissue: Callus, score: 78.812	N	N	N	N
vg0401709039	C -> T	LOC_Os04g03796.4	downstream_gene_variant ; 2375.0bp to feature; MODIFIER	silent_mutation	Average:36.258; most accessible tissue: Callus, score: 78.812	N	N	N	N
vg0401709039	C -> T	LOC_Os04g03796.1	intron_variant ; MODIFIER	silent_mutation	Average:36.258; most accessible tissue: Callus, score: 78.812	N	N	N	N
vg0401709039	C -> T	LOC_Os04g03796.2	intron_variant ; MODIFIER	silent_mutation	Average:36.258; most accessible tissue: Callus, score: 78.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401709039	2.94E-06	NA	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	1.87E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	1.21E-07	NA	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	1.22E-06	4.67E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	7.86E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	4.43E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	3.57E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	2.94E-06	3.07E-06	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	9.67E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039	NA	4.19E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251