Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401702548:

Variant ID: vg0401702548 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1702548
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCTAGCAAATCAAATTATATATATGCATTAATTTCAGTTACTGTACAAGATATATACACTATATATTCATGTATATCCAATGTATATAAGTATTACT[A/G]
ACTTAATTAGAACTAGAAATAGAGATCTCGTGCATCTGACGGCTTGGCTCCTTTAATTAAATTTGCAGCAAGGAAGAAGCGCACGACTCGATGATATACA

Reverse complement sequence

TGTATATCATCGAGTCGTGCGCTTCTTCCTTGCTGCAAATTTAATTAAAGGAGCCAAGCCGTCAGATGCACGAGATCTCTATTTCTAGTTCTAATTAAGT[T/C]
AGTAATACTTATATACATTGGATATACATGAATATATAGTGTATATATCTTGTACAGTAACTGAAATTAATGCATATATATAATTTGATTTGCTAGGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 15.20% 0.78% 47.14% NA
All Indica  2759 14.70% 19.60% 1.20% 64.48% NA
All Japonica  1512 75.40% 7.10% 0.20% 17.26% NA
Aus  269 55.00% 4.80% 0.00% 40.15% NA
Indica I  595 26.70% 12.90% 1.18% 59.16% NA
Indica II  465 11.40% 41.50% 2.15% 44.95% NA
Indica III  913 4.40% 8.40% 1.10% 86.09% NA
Indica Intermediate  786 19.60% 24.70% 0.76% 54.96% NA
Temperate Japonica  767 76.50% 11.00% 0.26% 12.26% NA
Tropical Japonica  504 73.20% 3.40% 0.20% 23.21% NA
Japonica Intermediate  241 76.30% 2.90% 0.00% 20.75% NA
VI/Aromatic  96 13.50% 35.40% 0.00% 51.04% NA
Intermediate  90 42.20% 22.20% 1.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401702548 A -> DEL N N silent_mutation Average:58.968; most accessible tissue: Minghui63 flag leaf, score: 93.186 N N N N
vg0401702548 A -> G LOC_Os04g03796.2 upstream_gene_variant ; 2841.0bp to feature; MODIFIER silent_mutation Average:58.968; most accessible tissue: Minghui63 flag leaf, score: 93.186 N N N N
vg0401702548 A -> G LOC_Os04g03796.1 intron_variant ; MODIFIER silent_mutation Average:58.968; most accessible tissue: Minghui63 flag leaf, score: 93.186 N N N N
vg0401702548 A -> G LOC_Os04g03796.3 intron_variant ; MODIFIER silent_mutation Average:58.968; most accessible tissue: Minghui63 flag leaf, score: 93.186 N N N N
vg0401702548 A -> G LOC_Os04g03796.4 intron_variant ; MODIFIER silent_mutation Average:58.968; most accessible tissue: Minghui63 flag leaf, score: 93.186 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401702548 A G -0.01 0.01 0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401702548 NA 7.17E-06 mr1170 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 2.49E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 1.92E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 9.72E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 6.54E-06 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 8.58E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 8.23E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 7.39E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 7.77E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401702548 NA 4.09E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251