Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401701969:

Variant ID: vg0401701969 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1701969
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCAGGAAGCATTACACACACTGCACCTACCGGGTAATTTAATTTCCCTGAATCCGTGTCCTCCATCGTCTACCTCGCTCGCAACAAGTACTACGGTTT[C/T]
TGAATATAAATAGCAGACGATCGATGCAAAGCCTTGCACAGTATACGTAAGTACCTAGCTTGACCGCCAGTTAGTTAATTAAACTCTATCAGACTCATGG

Reverse complement sequence

CCATGAGTCTGATAGAGTTTAATTAACTAACTGGCGGTCAAGCTAGGTACTTACGTATACTGTGCAAGGCTTTGCATCGATCGTCTGCTATTTATATTCA[G/A]
AAACCGTAGTACTTGTTGCGAGCGAGGTAGACGATGGAGGACACGGATTCAGGGAAATTAAATTACCCGGTAGGTGCAGTGTGTGTAATGCTTCCTGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 22.30% 2.69% 38.64% NA
All Indica  2759 29.80% 15.60% 3.55% 51.07% NA
All Japonica  1512 52.60% 28.70% 0.93% 17.79% NA
Aus  269 10.40% 49.40% 0.74% 39.41% NA
Indica I  595 38.30% 1.30% 1.51% 58.82% NA
Indica II  465 48.00% 18.10% 6.67% 27.31% NA
Indica III  913 9.00% 26.10% 4.71% 60.24% NA
Indica Intermediate  786 36.60% 12.80% 1.91% 48.60% NA
Temperate Japonica  767 82.80% 4.30% 0.65% 12.26% NA
Tropical Japonica  504 18.10% 56.70% 1.59% 23.61% NA
Japonica Intermediate  241 28.60% 47.70% 0.41% 23.24% NA
VI/Aromatic  96 36.50% 36.50% 9.38% 17.71% NA
Intermediate  90 44.40% 23.30% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401701969 C -> DEL N N silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N
vg0401701969 C -> T LOC_Os04g03796.1 upstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N
vg0401701969 C -> T LOC_Os04g03796.3 upstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N
vg0401701969 C -> T LOC_Os04g03796.4 upstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N
vg0401701969 C -> T LOC_Os04g03796.2 upstream_gene_variant ; 3420.0bp to feature; MODIFIER silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N
vg0401701969 C -> T LOC_Os04g03790-LOC_Os04g03796 intergenic_region ; MODIFIER silent_mutation Average:65.538; most accessible tissue: Callus, score: 92.173 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401701969 C T 0.15 -0.02 -0.02 -0.04 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401701969 8.86E-06 NA mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701969 NA 4.24E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701969 5.40E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701969 NA 2.28E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701969 NA 3.11E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701969 8.58E-09 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251